Multiple sequence alignment - TraesCS3A01G181300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G181300 chr3A 100.000 3053 0 0 1 3053 209524298 209527350 0 5638
1 TraesCS3A01G181300 chr3A 99.214 3053 24 0 1 3053 209426943 209423891 0 5505
2 TraesCS3A01G181300 chr3A 98.821 3053 36 0 1 3053 209543153 209540101 0 5439
3 TraesCS3A01G181300 chr3A 96.718 975 32 0 1 975 209503747 209504721 0 1624
4 TraesCS3A01G181300 chr3A 96.615 975 33 0 1 975 209560747 209559773 0 1618
5 TraesCS3A01G181300 chr3A 96.513 975 34 0 1 975 209447494 209446520 0 1613
6 TraesCS3A01G181300 chr3A 94.872 975 50 0 1 975 429410082 429409108 0 1524
7 TraesCS3A01G181300 chr6B 98.554 2074 29 1 981 3053 596615492 596613419 0 3663
8 TraesCS3A01G181300 chr2B 98.368 2083 33 1 972 3053 799240755 799242837 0 3657
9 TraesCS3A01G181300 chr7B 98.457 2074 31 1 981 3053 743096232 743094159 0 3651
10 TraesCS3A01G181300 chr7B 98.266 2076 33 2 981 3053 644446769 644444694 0 3631
11 TraesCS3A01G181300 chr7D 98.272 2083 33 3 972 3053 382073013 382075093 0 3644
12 TraesCS3A01G181300 chrUn 98.224 2083 32 2 972 3053 170994666 170996744 0 3637
13 TraesCS3A01G181300 chr1D 98.312 2074 34 1 981 3053 212459196 212457123 0 3635
14 TraesCS3A01G181300 chr6A 94.980 976 48 1 1 975 449757236 449758211 0 1530
15 TraesCS3A01G181300 chr1A 94.974 975 49 0 1 975 384371907 384372881 0 1530
16 TraesCS3A01G181300 chr1A 94.769 975 51 0 1 975 313605238 313604264 0 1519


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G181300 chr3A 209524298 209527350 3052 False 5638 5638 100.000 1 3053 1 chr3A.!!$F2 3052
1 TraesCS3A01G181300 chr3A 209423891 209426943 3052 True 5505 5505 99.214 1 3053 1 chr3A.!!$R1 3052
2 TraesCS3A01G181300 chr3A 209540101 209543153 3052 True 5439 5439 98.821 1 3053 1 chr3A.!!$R3 3052
3 TraesCS3A01G181300 chr3A 209503747 209504721 974 False 1624 1624 96.718 1 975 1 chr3A.!!$F1 974
4 TraesCS3A01G181300 chr3A 209559773 209560747 974 True 1618 1618 96.615 1 975 1 chr3A.!!$R4 974
5 TraesCS3A01G181300 chr3A 209446520 209447494 974 True 1613 1613 96.513 1 975 1 chr3A.!!$R2 974
6 TraesCS3A01G181300 chr3A 429409108 429410082 974 True 1524 1524 94.872 1 975 1 chr3A.!!$R5 974
7 TraesCS3A01G181300 chr6B 596613419 596615492 2073 True 3663 3663 98.554 981 3053 1 chr6B.!!$R1 2072
8 TraesCS3A01G181300 chr2B 799240755 799242837 2082 False 3657 3657 98.368 972 3053 1 chr2B.!!$F1 2081
9 TraesCS3A01G181300 chr7B 743094159 743096232 2073 True 3651 3651 98.457 981 3053 1 chr7B.!!$R2 2072
10 TraesCS3A01G181300 chr7B 644444694 644446769 2075 True 3631 3631 98.266 981 3053 1 chr7B.!!$R1 2072
11 TraesCS3A01G181300 chr7D 382073013 382075093 2080 False 3644 3644 98.272 972 3053 1 chr7D.!!$F1 2081
12 TraesCS3A01G181300 chrUn 170994666 170996744 2078 False 3637 3637 98.224 972 3053 1 chrUn.!!$F1 2081
13 TraesCS3A01G181300 chr1D 212457123 212459196 2073 True 3635 3635 98.312 981 3053 1 chr1D.!!$R1 2072
14 TraesCS3A01G181300 chr6A 449757236 449758211 975 False 1530 1530 94.980 1 975 1 chr6A.!!$F1 974
15 TraesCS3A01G181300 chr1A 384371907 384372881 974 False 1530 1530 94.974 1 975 1 chr1A.!!$F1 974
16 TraesCS3A01G181300 chr1A 313604264 313605238 974 True 1519 1519 94.769 1 975 1 chr1A.!!$R1 974

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
293 295 3.531015 GCGTGTTGTTTGCTTATTTTGC 58.469 40.909 0.0 0.0 0.0 3.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2254 2379 0.525455 GAATTTTGCCCGCATCCGAC 60.525 55.0 0.0 0.0 36.29 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 295 3.531015 GCGTGTTGTTTGCTTATTTTGC 58.469 40.909 0.00 0.0 0.00 3.68
1320 1322 5.105228 TGCTCCCAGAAATGAATGGATTTTC 60.105 40.000 0.00 0.0 39.02 2.29
2191 2315 3.482232 AAGCGGCTGTTGCTCACCT 62.482 57.895 1.81 0.0 43.14 4.00
2254 2379 2.735151 GGGGTGAACAAGAATTAGGGG 58.265 52.381 0.00 0.0 0.00 4.79
2536 2661 1.219664 CGGGCCATGGACTAAACGA 59.780 57.895 19.55 0.0 0.00 3.85
2981 3110 1.073923 GCCCAGAAGAAGAAAGACCCA 59.926 52.381 0.00 0.0 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
247 248 7.254084 GCGAAAAACAGAATCTGTCAAAAACAT 60.254 33.333 17.02 0.00 44.62 2.71
681 683 5.687730 AGACTCAAATCATACAATACGCTCG 59.312 40.000 0.00 0.00 0.00 5.03
1150 1152 1.154197 GCCTGAAGTCGTGTAAACCC 58.846 55.000 0.00 0.00 0.00 4.11
1320 1322 5.447624 TGGCATTCAATCTCATATTGCAG 57.552 39.130 0.00 0.00 0.00 4.41
1801 1892 2.379907 TCAAAGGAAAGGAGGAGGCAAT 59.620 45.455 0.00 0.00 0.00 3.56
2088 2212 3.773119 TCCCGAGAGCCAAAAGTATTACT 59.227 43.478 0.00 0.00 0.00 2.24
2089 2213 4.120589 CTCCCGAGAGCCAAAAGTATTAC 58.879 47.826 0.00 0.00 32.13 1.89
2191 2315 2.541346 GTGACCTCGTACGATCGTATCA 59.459 50.000 29.02 23.66 32.82 2.15
2254 2379 0.525455 GAATTTTGCCCGCATCCGAC 60.525 55.000 0.00 0.00 36.29 4.79
2536 2661 1.729586 TAGTCCTTTCAGGCAGTGGT 58.270 50.000 0.00 0.00 34.61 4.16
2981 3110 2.681344 GGATTTCCAAATCGTTAGCGGT 59.319 45.455 0.00 0.00 44.43 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.