Multiple sequence alignment - TraesCS3A01G173700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G173700 chr3A 100.000 2357 0 0 1 2357 191855550 191857906 0.000000e+00 4353
1 TraesCS3A01G173700 chr1A 98.516 2358 34 1 1 2357 278506347 278508704 0.000000e+00 4159
2 TraesCS3A01G173700 chr1A 99.310 1884 13 0 1 1884 238109744 238107861 0.000000e+00 3408
3 TraesCS3A01G173700 chr1A 99.151 1884 16 0 1 1884 238155129 238153246 0.000000e+00 3391
4 TraesCS3A01G173700 chr7A 98.388 2357 37 1 1 2357 563531480 563529125 0.000000e+00 4141
5 TraesCS3A01G173700 chr7A 98.938 1884 20 0 1 1884 60329009 60327126 0.000000e+00 3369
6 TraesCS3A01G173700 chr5A 99.151 1884 16 0 1 1884 16577919 16576036 0.000000e+00 3391
7 TraesCS3A01G173700 chr7D 99.098 1884 17 0 1 1884 579015579 579017462 0.000000e+00 3386
8 TraesCS3A01G173700 chr7D 100.000 77 0 0 2281 2357 382095732 382095808 2.440000e-30 143
9 TraesCS3A01G173700 chr6B 99.045 1884 17 1 1 1884 596657305 596655423 0.000000e+00 3378
10 TraesCS3A01G173700 chrUn 98.992 1884 16 1 1 1884 237257829 237255949 0.000000e+00 3371
11 TraesCS3A01G173700 chrUn 100.000 77 0 0 2281 2357 325544762 325544686 2.440000e-30 143
12 TraesCS3A01G173700 chrUn 100.000 77 0 0 2281 2357 325547858 325547782 2.440000e-30 143
13 TraesCS3A01G173700 chrUn 100.000 77 0 0 2281 2357 369393938 369394014 2.440000e-30 143
14 TraesCS3A01G173700 chr4A 97.250 509 13 1 1849 2357 275502889 275502382 0.000000e+00 861
15 TraesCS3A01G173700 chr1D 95.789 285 11 1 2071 2355 461637087 461636804 2.130000e-125 459
16 TraesCS3A01G173700 chr2A 98.438 256 4 0 1797 2052 588457946 588458201 3.570000e-123 451
17 TraesCS3A01G173700 chr7B 100.000 119 0 0 2102 2220 740000501 740000383 1.100000e-53 220
18 TraesCS3A01G173700 chr3D 100.000 77 0 0 2281 2357 501844032 501844108 2.440000e-30 143


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G173700 chr3A 191855550 191857906 2356 False 4353 4353 100.000 1 2357 1 chr3A.!!$F1 2356
1 TraesCS3A01G173700 chr1A 278506347 278508704 2357 False 4159 4159 98.516 1 2357 1 chr1A.!!$F1 2356
2 TraesCS3A01G173700 chr1A 238107861 238109744 1883 True 3408 3408 99.310 1 1884 1 chr1A.!!$R1 1883
3 TraesCS3A01G173700 chr1A 238153246 238155129 1883 True 3391 3391 99.151 1 1884 1 chr1A.!!$R2 1883
4 TraesCS3A01G173700 chr7A 563529125 563531480 2355 True 4141 4141 98.388 1 2357 1 chr7A.!!$R2 2356
5 TraesCS3A01G173700 chr7A 60327126 60329009 1883 True 3369 3369 98.938 1 1884 1 chr7A.!!$R1 1883
6 TraesCS3A01G173700 chr5A 16576036 16577919 1883 True 3391 3391 99.151 1 1884 1 chr5A.!!$R1 1883
7 TraesCS3A01G173700 chr7D 579015579 579017462 1883 False 3386 3386 99.098 1 1884 1 chr7D.!!$F2 1883
8 TraesCS3A01G173700 chr6B 596655423 596657305 1882 True 3378 3378 99.045 1 1884 1 chr6B.!!$R1 1883
9 TraesCS3A01G173700 chrUn 237255949 237257829 1880 True 3371 3371 98.992 1 1884 1 chrUn.!!$R1 1883
10 TraesCS3A01G173700 chr4A 275502382 275502889 507 True 861 861 97.250 1849 2357 1 chr4A.!!$R1 508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
138 139 0.473694 TTCAGGCAGGTGAGGAAGGA 60.474 55.000 0.00 0.0 0.0 3.36 F
586 587 3.094484 AGCTGCTTAGTGACTAGGAGT 57.906 47.619 5.87 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1125 1127 1.209504 GAGGGATCGGAACCACATTCA 59.790 52.381 6.63 0.0 39.30 2.57 R
1695 1698 2.290514 CCAGCAAATCCTTGACTCCTCA 60.291 50.000 0.00 0.0 34.14 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 4.808414 TCATGACGAGAATGGACTTCTT 57.192 40.909 0.00 0.0 44.42 2.52
138 139 0.473694 TTCAGGCAGGTGAGGAAGGA 60.474 55.000 0.00 0.0 0.00 3.36
586 587 3.094484 AGCTGCTTAGTGACTAGGAGT 57.906 47.619 5.87 0.0 0.00 3.85
725 726 7.882271 GGTAGGATGCTCATAGATGAAGAAAAT 59.118 37.037 0.00 0.0 36.18 1.82
1125 1127 3.963129 TCCAGAAAAATTGTCGGCCTAT 58.037 40.909 0.00 0.0 0.00 2.57
1695 1698 4.640201 CAGGTGTGAAATCCCATCGTATTT 59.360 41.667 0.00 0.0 0.00 1.40
2051 2054 6.128902 GCGTCGAGATTAATAAAATCGTGGAT 60.129 38.462 0.00 0.0 35.05 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 6.931838 ACTCTTCTAAACCATTACATGACGA 58.068 36.000 0.00 0.00 0.00 4.20
85 86 3.195182 TCTCCTTCGTCTAGTCGAGAAGA 59.805 47.826 11.73 12.29 41.73 2.87
586 587 2.034066 CAAGAAAGGGGCGCTCCA 59.966 61.111 31.81 0.00 37.22 3.86
725 726 4.262894 CCAGAACCACTTGCCTAAAGTCTA 60.263 45.833 0.00 0.00 46.60 2.59
1125 1127 1.209504 GAGGGATCGGAACCACATTCA 59.790 52.381 6.63 0.00 39.30 2.57
1695 1698 2.290514 CCAGCAAATCCTTGACTCCTCA 60.291 50.000 0.00 0.00 34.14 3.86
2051 2054 5.393787 GGTTAGCCAATACGGATCGATATCA 60.394 44.000 0.00 0.00 36.56 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.