Multiple sequence alignment - TraesCS3A01G166400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G166400 chr3A 100.000 2901 0 0 1 2901 171149704 171152604 0.000000e+00 5358.0
1 TraesCS3A01G166400 chr3A 97.278 2902 77 2 1 2901 545676848 545673948 0.000000e+00 4920.0
2 TraesCS3A01G166400 chr3A 97.348 2904 56 9 1 2901 58078827 58075942 0.000000e+00 4916.0
3 TraesCS3A01G166400 chr3A 97.501 1881 45 2 1021 2901 122115255 122117133 0.000000e+00 3212.0
4 TraesCS3A01G166400 chr3A 96.923 1885 54 2 1021 2901 48905594 48907478 0.000000e+00 3157.0
5 TraesCS3A01G166400 chr1A 98.001 2902 57 1 1 2901 359190263 359193164 0.000000e+00 5036.0
6 TraesCS3A01G166400 chr1A 97.727 2904 62 3 1 2901 181971146 181968244 0.000000e+00 4994.0
7 TraesCS3A01G166400 chr1A 97.174 2654 58 5 249 2901 579041828 579039191 0.000000e+00 4470.0
8 TraesCS3A01G166400 chr1A 97.225 2414 51 4 489 2901 67962183 67959785 0.000000e+00 4072.0
9 TraesCS3A01G166400 chr1A 91.935 62 4 1 22 82 581435381 581435442 5.150000e-13 86.1
10 TraesCS3A01G166400 chr7A 96.920 1883 54 3 1021 2901 723589399 723591279 0.000000e+00 3153.0
11 TraesCS3A01G166400 chr7A 97.570 535 13 0 489 1023 662680420 662680954 0.000000e+00 917.0
12 TraesCS3A01G166400 chr7A 97.358 492 11 2 1 491 662679326 662679816 0.000000e+00 835.0
13 TraesCS3A01G166400 chr4D 96.586 498 13 2 489 986 446550868 446550375 0.000000e+00 822.0
14 TraesCS3A01G166400 chr4D 97.067 375 7 1 117 491 99933897 99934267 1.900000e-176 628.0
15 TraesCS3A01G166400 chr1D 96.586 498 14 2 489 986 308936650 308937144 0.000000e+00 822.0
16 TraesCS3A01G166400 chr1D 97.326 374 6 1 118 491 308935677 308936046 1.470000e-177 632.0
17 TraesCS3A01G166400 chr7B 96.543 376 8 2 117 491 574900768 574900397 4.110000e-173 617.0
18 TraesCS3A01G166400 chr6A 92.929 99 6 1 22 119 430939729 430939631 3.010000e-30 143.0
19 TraesCS3A01G166400 chr3D 96.491 57 2 0 63 119 535391692 535391748 8.560000e-16 95.3
20 TraesCS3A01G166400 chr4B 91.935 62 4 1 22 82 563222728 563222789 5.150000e-13 86.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G166400 chr3A 171149704 171152604 2900 False 5358 5358 100.000 1 2901 1 chr3A.!!$F3 2900
1 TraesCS3A01G166400 chr3A 545673948 545676848 2900 True 4920 4920 97.278 1 2901 1 chr3A.!!$R2 2900
2 TraesCS3A01G166400 chr3A 58075942 58078827 2885 True 4916 4916 97.348 1 2901 1 chr3A.!!$R1 2900
3 TraesCS3A01G166400 chr3A 122115255 122117133 1878 False 3212 3212 97.501 1021 2901 1 chr3A.!!$F2 1880
4 TraesCS3A01G166400 chr3A 48905594 48907478 1884 False 3157 3157 96.923 1021 2901 1 chr3A.!!$F1 1880
5 TraesCS3A01G166400 chr1A 359190263 359193164 2901 False 5036 5036 98.001 1 2901 1 chr1A.!!$F1 2900
6 TraesCS3A01G166400 chr1A 181968244 181971146 2902 True 4994 4994 97.727 1 2901 1 chr1A.!!$R2 2900
7 TraesCS3A01G166400 chr1A 579039191 579041828 2637 True 4470 4470 97.174 249 2901 1 chr1A.!!$R3 2652
8 TraesCS3A01G166400 chr1A 67959785 67962183 2398 True 4072 4072 97.225 489 2901 1 chr1A.!!$R1 2412
9 TraesCS3A01G166400 chr7A 723589399 723591279 1880 False 3153 3153 96.920 1021 2901 1 chr7A.!!$F1 1880
10 TraesCS3A01G166400 chr7A 662679326 662680954 1628 False 876 917 97.464 1 1023 2 chr7A.!!$F2 1022
11 TraesCS3A01G166400 chr1D 308935677 308937144 1467 False 727 822 96.956 118 986 2 chr1D.!!$F1 868

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
557 1166 0.820074 TGTTGTTGTACAAGCGGGGG 60.820 55.000 8.98 0.0 39.00 5.40 F
1545 2154 1.633945 CCCTACCCTTACAGCTGGTTT 59.366 52.381 19.93 0.0 33.55 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1593 2202 0.878086 TGCGCACATCGAACAACTCA 60.878 50.000 5.66 0.0 41.67 3.41 R
2589 3203 4.281688 CCTTGTCAGGTTTCCATTTGACAT 59.718 41.667 6.95 0.0 46.39 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 1.153429 GACGTATGGAGTGGGTGCC 60.153 63.158 0.00 0.00 0.00 5.01
557 1166 0.820074 TGTTGTTGTACAAGCGGGGG 60.820 55.000 8.98 0.00 39.00 5.40
1044 1653 6.654161 CAGAGAACTTCAAGGACAAGATCAAT 59.346 38.462 0.00 0.00 0.00 2.57
1046 1655 6.302269 AGAACTTCAAGGACAAGATCAATGT 58.698 36.000 4.05 4.05 0.00 2.71
1199 1808 5.221722 ACTCCTCTGACTGCTATTTTTCACA 60.222 40.000 0.00 0.00 0.00 3.58
1261 1870 4.521256 CCTCCTGTCTAGTATAGGACAAGC 59.479 50.000 7.86 0.00 40.36 4.01
1545 2154 1.633945 CCCTACCCTTACAGCTGGTTT 59.366 52.381 19.93 0.00 33.55 3.27
1593 2202 4.074970 GGGTTCAACAACTCTGATGTGAT 58.925 43.478 0.00 0.00 32.50 3.06
1618 2227 1.300542 TTCGATGTGCGCAGTGTCA 60.301 52.632 12.22 5.37 40.61 3.58
1649 2258 4.081420 GTCAGGCTAGGTTGAAGAAGATGA 60.081 45.833 0.00 0.00 0.00 2.92
1726 2335 0.108138 GGAACATCTCCACCTCGGTG 60.108 60.000 9.13 9.13 44.67 4.94
2140 2752 4.086457 TCCCTCCTTAATTCAAAGCCAAC 58.914 43.478 0.00 0.00 0.00 3.77
2160 2772 6.086222 CCAACACACTTATTTTTGATCGGAG 58.914 40.000 0.00 0.00 0.00 4.63
2637 3251 7.398047 GGGGGTCCAAGTTATAATAGTTGTTTT 59.602 37.037 0.00 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 3.006537 CCACTCCATACGTCCGGAAATAT 59.993 47.826 5.23 4.04 0.00 1.28
41 43 0.321919 GAGTTGCATCAGCTGGGACA 60.322 55.000 15.13 6.63 42.74 4.02
1044 1653 1.544537 GCCATAACACTGGTCACCACA 60.545 52.381 0.00 0.00 38.63 4.17
1046 1655 0.321210 CGCCATAACACTGGTCACCA 60.321 55.000 0.00 0.00 38.63 4.17
1222 1831 5.640147 ACAGGAGGTCCAATTAACATTTGA 58.360 37.500 0.00 0.00 38.89 2.69
1261 1870 6.500684 AAAACACATACTAGCATTCACTGG 57.499 37.500 0.00 0.00 0.00 4.00
1545 2154 1.205055 TCTACAACCCACACCACACA 58.795 50.000 0.00 0.00 0.00 3.72
1593 2202 0.878086 TGCGCACATCGAACAACTCA 60.878 50.000 5.66 0.00 41.67 3.41
1618 2227 3.327757 TCAACCTAGCCTGACACTTCATT 59.672 43.478 0.00 0.00 0.00 2.57
1649 2258 1.686110 CAGGCTCCCCCTTACTCGT 60.686 63.158 0.00 0.00 43.06 4.18
1726 2335 4.934602 AGCAGCAGAGAGAAAGTGAATAAC 59.065 41.667 0.00 0.00 0.00 1.89
2096 2708 5.766174 GGAGTACATAGAAACCAACAACCAA 59.234 40.000 0.00 0.00 0.00 3.67
2140 2752 4.941263 TCCCTCCGATCAAAAATAAGTGTG 59.059 41.667 0.00 0.00 0.00 3.82
2160 2772 4.065789 GGCTATTACAAGCATGTACTCCC 58.934 47.826 0.32 0.00 44.64 4.30
2589 3203 4.281688 CCTTGTCAGGTTTCCATTTGACAT 59.718 41.667 6.95 0.00 46.39 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.