Multiple sequence alignment - TraesCS3A01G152400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G152400 chr3A 100.000 2144 0 0 1 2144 142911312 142909169 0.000000e+00 3960
1 TraesCS3A01G152400 chr3A 87.090 457 55 2 1689 2144 727173795 727173342 4.080000e-142 514
2 TraesCS3A01G152400 chr5A 98.698 2150 20 3 1 2144 423037845 423035698 0.000000e+00 3808
3 TraesCS3A01G152400 chr5A 97.840 1713 30 2 1 1707 662627478 662625767 0.000000e+00 2952
4 TraesCS3A01G152400 chr5A 99.184 490 3 1 1656 2144 662625770 662625281 0.000000e+00 881
5 TraesCS3A01G152400 chr3D 95.745 1692 54 10 1 1685 497963251 497964931 0.000000e+00 2710
6 TraesCS3A01G152400 chr3D 95.275 1693 67 9 1 1685 49542535 49544222 0.000000e+00 2671
7 TraesCS3A01G152400 chr3D 94.458 397 21 1 1749 2144 49545023 49545419 5.060000e-171 610
8 TraesCS3A01G152400 chr3D 94.458 397 21 1 1749 2144 497965739 497966135 5.060000e-171 610
9 TraesCS3A01G152400 chr2A 94.405 1698 86 4 1 1690 58556432 58554736 0.000000e+00 2601
10 TraesCS3A01G152400 chr7B 94.291 1699 86 7 1 1690 20886069 20887765 0.000000e+00 2590
11 TraesCS3A01G152400 chr7D 95.741 1268 42 4 1 1261 4251191 4252453 0.000000e+00 2032
12 TraesCS3A01G152400 chr7D 92.715 453 31 2 1693 2144 121192015 121192466 0.000000e+00 652
13 TraesCS3A01G152400 chr7D 92.123 457 34 2 1689 2144 121795367 121794912 0.000000e+00 643
14 TraesCS3A01G152400 chr7D 94.710 397 20 1 1749 2144 4253606 4254002 1.090000e-172 616
15 TraesCS3A01G152400 chr7D 89.407 472 48 2 1220 1690 22667900 22668370 5.090000e-166 593
16 TraesCS3A01G152400 chr1A 94.557 1286 59 6 1 1277 298619719 298618436 0.000000e+00 1977
17 TraesCS3A01G152400 chr1A 92.417 844 62 2 848 1690 395491050 395490208 0.000000e+00 1203
18 TraesCS3A01G152400 chr3B 93.963 1292 67 6 1 1283 754453324 754454613 0.000000e+00 1943
19 TraesCS3A01G152400 chr5D 90.254 472 45 1 1220 1690 396167613 396167142 1.090000e-172 616
20 TraesCS3A01G152400 chr5B 89.278 457 45 2 1689 2144 676268624 676268171 8.590000e-159 569


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G152400 chr3A 142909169 142911312 2143 True 3960.0 3960 100.0000 1 2144 1 chr3A.!!$R1 2143
1 TraesCS3A01G152400 chr5A 423035698 423037845 2147 True 3808.0 3808 98.6980 1 2144 1 chr5A.!!$R1 2143
2 TraesCS3A01G152400 chr5A 662625281 662627478 2197 True 1916.5 2952 98.5120 1 2144 2 chr5A.!!$R2 2143
3 TraesCS3A01G152400 chr3D 497963251 497966135 2884 False 1660.0 2710 95.1015 1 2144 2 chr3D.!!$F2 2143
4 TraesCS3A01G152400 chr3D 49542535 49545419 2884 False 1640.5 2671 94.8665 1 2144 2 chr3D.!!$F1 2143
5 TraesCS3A01G152400 chr2A 58554736 58556432 1696 True 2601.0 2601 94.4050 1 1690 1 chr2A.!!$R1 1689
6 TraesCS3A01G152400 chr7B 20886069 20887765 1696 False 2590.0 2590 94.2910 1 1690 1 chr7B.!!$F1 1689
7 TraesCS3A01G152400 chr7D 4251191 4254002 2811 False 1324.0 2032 95.2255 1 2144 2 chr7D.!!$F3 2143
8 TraesCS3A01G152400 chr1A 298618436 298619719 1283 True 1977.0 1977 94.5570 1 1277 1 chr1A.!!$R1 1276
9 TraesCS3A01G152400 chr1A 395490208 395491050 842 True 1203.0 1203 92.4170 848 1690 1 chr1A.!!$R2 842
10 TraesCS3A01G152400 chr3B 754453324 754454613 1289 False 1943.0 1943 93.9630 1 1283 1 chr3B.!!$F1 1282

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
331 338 8.498054 TGATAGCACTTCTGAAATTCCTTTAG 57.502 34.615 0.0 0.0 0.0 1.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1270 1279 3.265791 CAAGCTCATTGACTACCCTGAC 58.734 50.0 0.0 0.0 41.83 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 338 8.498054 TGATAGCACTTCTGAAATTCCTTTAG 57.502 34.615 0.0 0.0 0.00 1.85
1320 1330 1.215244 CAGAGCATAGGATGTGTGCG 58.785 55.000 0.0 0.0 43.37 5.34
1322 1332 1.690893 AGAGCATAGGATGTGTGCGAT 59.309 47.619 0.0 0.0 43.37 4.58
1429 1441 5.539955 AGAAGCCAATTCAATTACAACAGGT 59.460 36.000 0.0 0.0 40.67 4.00
1600 1614 9.126151 TGAGATCAAGGTTCTACTCTGTAATAG 57.874 37.037 0.0 0.0 0.00 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 338 2.633488 GAAGGCCATACCAACAGAGAC 58.367 52.381 5.01 0.0 43.14 3.36
1270 1279 3.265791 CAAGCTCATTGACTACCCTGAC 58.734 50.000 0.00 0.0 41.83 3.51
1320 1330 8.662781 TTCTCCAGTTAGCATAAATGTGTATC 57.337 34.615 0.00 0.0 0.00 2.24
1322 1332 8.856153 TTTTCTCCAGTTAGCATAAATGTGTA 57.144 30.769 0.00 0.0 0.00 2.90
1429 1441 3.694072 ACTGTGTTTTGTGCAAGCTTAGA 59.306 39.130 0.00 0.0 0.00 2.10
1600 1614 3.988379 TCTAATGATTTCCATTGCCGC 57.012 42.857 0.00 0.0 44.67 6.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.