Multiple sequence alignment - TraesCS3A01G147200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G147200 chr3A 100.000 3515 0 0 1 3515 128577407 128580921 0.000000e+00 6492
1 TraesCS3A01G147200 chr3A 87.714 700 74 9 2821 3515 673436371 673437063 0.000000e+00 806
2 TraesCS3A01G147200 chr1A 97.539 2601 57 3 921 3515 389806256 389803657 0.000000e+00 4442
3 TraesCS3A01G147200 chr1A 86.093 302 33 5 2821 3121 516558036 516557743 2.040000e-82 316
4 TraesCS3A01G147200 chr1D 95.123 1907 78 7 921 2820 309923863 309921965 0.000000e+00 2992
5 TraesCS3A01G147200 chr7B 99.023 921 8 1 1 921 356731722 356730803 0.000000e+00 1650
6 TraesCS3A01G147200 chr7B 93.872 718 37 4 38 755 709163049 709162339 0.000000e+00 1075
7 TraesCS3A01G147200 chr7B 93.733 718 38 3 38 755 709168089 709167379 0.000000e+00 1070
8 TraesCS3A01G147200 chr7B 93.454 718 40 5 38 755 709184510 709183800 0.000000e+00 1059
9 TraesCS3A01G147200 chr7B 92.897 718 39 4 38 755 709155614 709154909 0.000000e+00 1033
10 TraesCS3A01G147200 chr5A 98.370 920 11 2 1 920 643340382 643341297 0.000000e+00 1613
11 TraesCS3A01G147200 chr1B 94.924 985 49 1 1056 2040 419953177 419952194 0.000000e+00 1541
12 TraesCS3A01G147200 chr1B 96.450 507 18 0 2021 2527 419951956 419951450 0.000000e+00 837
13 TraesCS3A01G147200 chr1B 90.716 377 33 2 3140 3515 570825388 570825763 5.240000e-138 501
14 TraesCS3A01G147200 chr1B 89.655 116 12 0 921 1036 419953282 419953167 7.860000e-32 148
15 TraesCS3A01G147200 chr2D 82.543 1518 237 23 1005 2505 426920295 426921801 0.000000e+00 1310
16 TraesCS3A01G147200 chr2D 87.474 958 79 16 1 919 116803250 116802295 0.000000e+00 1066
17 TraesCS3A01G147200 chr2A 82.547 1484 232 21 1037 2505 562106200 562104729 0.000000e+00 1280
18 TraesCS3A01G147200 chr2A 93.733 718 38 3 38 755 39576105 39576815 0.000000e+00 1070
19 TraesCS3A01G147200 chr2A 86.577 298 35 4 2825 3121 715992876 715992583 1.220000e-84 324
20 TraesCS3A01G147200 chr2B 91.099 910 76 3 13 921 227229084 227229989 0.000000e+00 1227
21 TraesCS3A01G147200 chr5B 93.733 718 36 4 38 755 498827370 498828078 0.000000e+00 1068
22 TraesCS3A01G147200 chr5B 91.247 377 31 2 3140 3515 526267192 526266817 2.420000e-141 512
23 TraesCS3A01G147200 chr5B 78.607 201 29 10 2015 2202 676924335 676924534 1.710000e-23 121
24 TraesCS3A01G147200 chr6A 91.667 696 56 1 2820 3515 79323598 79324291 0.000000e+00 963
25 TraesCS3A01G147200 chr6A 88.704 301 32 1 2820 3120 558110423 558110721 1.990000e-97 366
26 TraesCS3A01G147200 chr6A 77.578 223 37 12 1988 2202 18520777 18520560 4.760000e-24 122
27 TraesCS3A01G147200 chr4A 91.535 697 54 4 2820 3515 616606133 616606825 0.000000e+00 955
28 TraesCS3A01G147200 chr4A 89.670 697 65 6 2820 3514 38664069 38664760 0.000000e+00 881
29 TraesCS3A01G147200 chr4A 73.482 494 95 28 2018 2491 634844488 634844011 1.690000e-33 154
30 TraesCS3A01G147200 chr3D 90.387 697 57 8 2821 3515 18792317 18791629 0.000000e+00 907
31 TraesCS3A01G147200 chr6B 90.716 377 33 2 3140 3515 669399470 669399095 5.240000e-138 501
32 TraesCS3A01G147200 chr4D 88.764 178 18 2 705 881 159293454 159293630 2.120000e-52 217
33 TraesCS3A01G147200 chr4B 90.184 163 15 1 759 921 575650283 575650444 9.890000e-51 211
34 TraesCS3A01G147200 chr6D 76.190 273 44 17 1942 2202 17828698 17828961 1.320000e-24 124


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G147200 chr3A 128577407 128580921 3514 False 6492 6492 100.000000 1 3515 1 chr3A.!!$F1 3514
1 TraesCS3A01G147200 chr3A 673436371 673437063 692 False 806 806 87.714000 2821 3515 1 chr3A.!!$F2 694
2 TraesCS3A01G147200 chr1A 389803657 389806256 2599 True 4442 4442 97.539000 921 3515 1 chr1A.!!$R1 2594
3 TraesCS3A01G147200 chr1D 309921965 309923863 1898 True 2992 2992 95.123000 921 2820 1 chr1D.!!$R1 1899
4 TraesCS3A01G147200 chr7B 356730803 356731722 919 True 1650 1650 99.023000 1 921 1 chr7B.!!$R1 920
5 TraesCS3A01G147200 chr7B 709162339 709163049 710 True 1075 1075 93.872000 38 755 1 chr7B.!!$R3 717
6 TraesCS3A01G147200 chr7B 709167379 709168089 710 True 1070 1070 93.733000 38 755 1 chr7B.!!$R4 717
7 TraesCS3A01G147200 chr7B 709183800 709184510 710 True 1059 1059 93.454000 38 755 1 chr7B.!!$R5 717
8 TraesCS3A01G147200 chr7B 709154909 709155614 705 True 1033 1033 92.897000 38 755 1 chr7B.!!$R2 717
9 TraesCS3A01G147200 chr5A 643340382 643341297 915 False 1613 1613 98.370000 1 920 1 chr5A.!!$F1 919
10 TraesCS3A01G147200 chr1B 419951450 419953282 1832 True 842 1541 93.676333 921 2527 3 chr1B.!!$R1 1606
11 TraesCS3A01G147200 chr2D 426920295 426921801 1506 False 1310 1310 82.543000 1005 2505 1 chr2D.!!$F1 1500
12 TraesCS3A01G147200 chr2D 116802295 116803250 955 True 1066 1066 87.474000 1 919 1 chr2D.!!$R1 918
13 TraesCS3A01G147200 chr2A 562104729 562106200 1471 True 1280 1280 82.547000 1037 2505 1 chr2A.!!$R1 1468
14 TraesCS3A01G147200 chr2A 39576105 39576815 710 False 1070 1070 93.733000 38 755 1 chr2A.!!$F1 717
15 TraesCS3A01G147200 chr2B 227229084 227229989 905 False 1227 1227 91.099000 13 921 1 chr2B.!!$F1 908
16 TraesCS3A01G147200 chr5B 498827370 498828078 708 False 1068 1068 93.733000 38 755 1 chr5B.!!$F1 717
17 TraesCS3A01G147200 chr6A 79323598 79324291 693 False 963 963 91.667000 2820 3515 1 chr6A.!!$F1 695
18 TraesCS3A01G147200 chr4A 616606133 616606825 692 False 955 955 91.535000 2820 3515 1 chr4A.!!$F2 695
19 TraesCS3A01G147200 chr4A 38664069 38664760 691 False 881 881 89.670000 2820 3514 1 chr4A.!!$F1 694
20 TraesCS3A01G147200 chr3D 18791629 18792317 688 True 907 907 90.387000 2821 3515 1 chr3D.!!$R1 694

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
986 1028 2.167693 CCTGAGGCTAAATCACGGTACA 59.832 50.0 0.0 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2806 3131 0.400213 TTTTCCGTGGAGATGGCAGT 59.6 50.0 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
840 882 6.731467 AGAATTAAGTGGGGAAATTAGAGCA 58.269 36.000 0.00 0.00 0.00 4.26
986 1028 2.167693 CCTGAGGCTAAATCACGGTACA 59.832 50.000 0.00 0.00 0.00 2.90
1797 1852 3.329688 CTTCGCCGTCGTGCTCTCT 62.330 63.158 4.57 0.00 36.96 3.10
1803 1858 1.794003 CGTCGTGCTCTCTGTCGTG 60.794 63.158 0.00 0.00 0.00 4.35
1805 1860 2.050077 CGTGCTCTCTGTCGTGCA 60.050 61.111 0.00 0.00 0.00 4.57
2328 2640 4.189188 CCACGGCCGGAGTACTCG 62.189 72.222 31.76 11.49 0.00 4.18
2731 3056 3.684788 GCGCTAGTCAAATTTCTCCTTCA 59.315 43.478 0.00 0.00 0.00 3.02
2806 3131 3.144121 TACCCCCACCCTCCCCAAA 62.144 63.158 0.00 0.00 0.00 3.28
2867 3193 0.963856 TCACGGCGTGTATCTCCACT 60.964 55.000 35.65 0.00 34.79 4.00
2918 3244 1.008449 AGCTGAGAAGGGCCCTACTAA 59.992 52.381 28.96 11.04 0.00 2.24
2999 3325 5.133221 CCCTTCGATGGTGGAATTAATTCT 58.867 41.667 23.85 7.28 37.00 2.40
3234 3560 5.445010 GGCATAGCTCGCAATTTTTGAAAAG 60.445 40.000 9.99 0.00 0.00 2.27
3296 3623 5.474825 TCGCCAAAACTCAAAGAACTTTTT 58.525 33.333 0.00 0.00 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
15 16 4.695455 GGTGCTTTGCTAACAGAAGTGATA 59.305 41.667 0.00 0.00 0.00 2.15
275 278 3.256558 GGCAATGAAGATTCAAACAGGC 58.743 45.455 0.00 0.00 41.13 4.85
840 882 2.026822 AGCCGTCAATTCCAATCTGACT 60.027 45.455 0.00 0.00 37.84 3.41
881 923 2.829720 AGTCCAACTATTACTGCACGGA 59.170 45.455 0.00 0.00 0.00 4.69
1660 1715 2.029828 TGTTCTCTTCGGCTCTCTTGAC 60.030 50.000 0.00 0.00 0.00 3.18
1803 1858 1.160329 GGGTGTAGATGGCGATGTGC 61.160 60.000 0.00 0.00 45.38 4.57
1805 1860 0.753262 GAGGGTGTAGATGGCGATGT 59.247 55.000 0.00 0.00 0.00 3.06
2731 3056 2.419297 CGGCAAGAGGAAGAAGCTACAT 60.419 50.000 0.00 0.00 0.00 2.29
2806 3131 0.400213 TTTTCCGTGGAGATGGCAGT 59.600 50.000 0.00 0.00 0.00 4.40
2852 3178 0.818296 AGACAGTGGAGATACACGCC 59.182 55.000 0.00 0.00 45.80 5.68
2867 3193 8.150296 CACATACATCATGGGTAGATTTAGACA 58.850 37.037 0.00 0.00 39.13 3.41
2918 3244 2.258109 GGACAAGACTAACCTGGGTCT 58.742 52.381 0.00 0.00 43.60 3.85
2999 3325 9.770097 CAAAATAGGCTAGAGAGATAATCACAA 57.230 33.333 0.00 0.00 0.00 3.33
3167 3493 6.839124 TCTATTTGTCATGGCAAAGTTCAT 57.161 33.333 27.65 14.89 41.00 2.57
3234 3560 5.958955 ACGGTTAACATGTTCTCTACCTAC 58.041 41.667 15.85 2.10 0.00 3.18
3249 3576 9.054191 CGATAAAGTTCCAAAAATACGGTTAAC 57.946 33.333 0.00 0.00 0.00 2.01
3336 3664 2.590821 AGAATGTGCCTGAACTTTGCT 58.409 42.857 0.00 0.00 0.00 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.