Multiple sequence alignment - TraesCS3A01G139500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G139500 chr3A 100.000 3800 0 0 1 3800 117804633 117808432 0.000000e+00 7018.0
1 TraesCS3A01G139500 chr3A 99.763 3800 9 0 1 3800 117833533 117837332 0.000000e+00 6968.0
2 TraesCS3A01G139500 chr3A 79.748 1590 278 23 1219 2801 555323564 555322012 0.000000e+00 1112.0
3 TraesCS3A01G139500 chr3A 79.308 1590 301 15 1220 2801 555532317 555530748 0.000000e+00 1088.0
4 TraesCS3A01G139500 chr3A 82.319 690 89 15 1885 2546 555661551 555660867 5.510000e-158 568.0
5 TraesCS3A01G139500 chr3A 81.594 690 94 15 1885 2546 555694753 555694069 1.200000e-149 540.0
6 TraesCS3A01G139500 chr3A 81.429 280 36 12 2623 2894 555694067 555693796 8.270000e-52 215.0
7 TraesCS3A01G139500 chr3A 81.071 280 37 12 2623 2894 555660865 555660594 3.850000e-50 209.0
8 TraesCS3A01G139500 chr3B 89.152 2996 232 44 439 3430 150656733 150659639 0.000000e+00 3646.0
9 TraesCS3A01G139500 chr3B 79.862 1589 273 26 1220 2801 151224895 151226443 0.000000e+00 1118.0
10 TraesCS3A01G139500 chr3B 79.384 1591 299 15 1220 2802 150950060 150951629 0.000000e+00 1094.0
11 TraesCS3A01G139500 chr3B 82.275 677 92 12 1893 2545 150854311 150854983 9.220000e-156 560.0
12 TraesCS3A01G139500 chr3B 79.167 624 103 8 684 1301 151224272 151224874 1.270000e-109 407.0
13 TraesCS3A01G139500 chr3B 85.638 188 27 0 2614 2801 150854977 150855164 8.330000e-47 198.0
14 TraesCS3A01G139500 chr3B 89.032 155 9 7 3580 3734 150659630 150659776 6.480000e-43 185.0
15 TraesCS3A01G139500 chr3B 82.258 124 18 3 3457 3578 743500848 743500969 1.870000e-18 104.0
16 TraesCS3A01G139500 chr3D 90.075 2388 182 26 437 2823 100226953 100229286 0.000000e+00 3046.0
17 TraesCS3A01G139500 chr3D 80.113 1589 272 22 1220 2801 100557453 100559004 0.000000e+00 1144.0
18 TraesCS3A01G139500 chr3D 79.660 1588 299 12 1220 2801 100462766 100464335 0.000000e+00 1122.0
19 TraesCS3A01G139500 chr3D 82.533 687 90 11 1885 2545 100394094 100394776 9.150000e-161 577.0
20 TraesCS3A01G139500 chr3D 86.585 410 29 13 2873 3281 100229283 100229667 2.710000e-116 429.0
21 TraesCS3A01G139500 chr3D 79.745 627 97 9 684 1301 100556827 100557432 9.750000e-116 427.0
22 TraesCS3A01G139500 chr3D 86.339 183 25 0 2614 2796 100394770 100394952 2.310000e-47 200.0
23 TraesCS3A01G139500 chr7A 95.541 157 6 1 3426 3581 712415718 712415874 2.270000e-62 250.0
24 TraesCS3A01G139500 chr4D 94.805 154 8 0 3429 3582 503794866 503795019 1.360000e-59 241.0
25 TraesCS3A01G139500 chr4D 93.421 152 10 0 3429 3580 441106815 441106966 3.820000e-55 226.0
26 TraesCS3A01G139500 chr2D 94.702 151 8 0 3430 3580 247094098 247094248 6.350000e-58 235.0
27 TraesCS3A01G139500 chr6A 92.000 150 12 0 3428 3577 568013701 568013850 1.070000e-50 211.0
28 TraesCS3A01G139500 chr2B 100.000 46 0 0 3755 3800 776233464 776233509 6.760000e-13 86.1
29 TraesCS3A01G139500 chr2A 97.826 46 1 0 3755 3800 759467619 759467664 3.150000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G139500 chr3A 117804633 117808432 3799 False 7018.0 7018 100.0000 1 3800 1 chr3A.!!$F1 3799
1 TraesCS3A01G139500 chr3A 117833533 117837332 3799 False 6968.0 6968 99.7630 1 3800 1 chr3A.!!$F2 3799
2 TraesCS3A01G139500 chr3A 555322012 555323564 1552 True 1112.0 1112 79.7480 1219 2801 1 chr3A.!!$R1 1582
3 TraesCS3A01G139500 chr3A 555530748 555532317 1569 True 1088.0 1088 79.3080 1220 2801 1 chr3A.!!$R2 1581
4 TraesCS3A01G139500 chr3A 555660594 555661551 957 True 388.5 568 81.6950 1885 2894 2 chr3A.!!$R3 1009
5 TraesCS3A01G139500 chr3A 555693796 555694753 957 True 377.5 540 81.5115 1885 2894 2 chr3A.!!$R4 1009
6 TraesCS3A01G139500 chr3B 150656733 150659776 3043 False 1915.5 3646 89.0920 439 3734 2 chr3B.!!$F3 3295
7 TraesCS3A01G139500 chr3B 150950060 150951629 1569 False 1094.0 1094 79.3840 1220 2802 1 chr3B.!!$F1 1582
8 TraesCS3A01G139500 chr3B 151224272 151226443 2171 False 762.5 1118 79.5145 684 2801 2 chr3B.!!$F5 2117
9 TraesCS3A01G139500 chr3B 150854311 150855164 853 False 379.0 560 83.9565 1893 2801 2 chr3B.!!$F4 908
10 TraesCS3A01G139500 chr3D 100226953 100229667 2714 False 1737.5 3046 88.3300 437 3281 2 chr3D.!!$F2 2844
11 TraesCS3A01G139500 chr3D 100462766 100464335 1569 False 1122.0 1122 79.6600 1220 2801 1 chr3D.!!$F1 1581
12 TraesCS3A01G139500 chr3D 100556827 100559004 2177 False 785.5 1144 79.9290 684 2801 2 chr3D.!!$F4 2117
13 TraesCS3A01G139500 chr3D 100394094 100394952 858 False 388.5 577 84.4360 1885 2796 2 chr3D.!!$F3 911

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
611 612 7.169308 CGTGTGATACTGGATTATTCTACCAAC 59.831 40.741 0.0 0.0 33.14 3.77 F
2475 2628 1.421485 GCATTCAGCAAGGTCGTCG 59.579 57.895 0.0 0.0 44.79 5.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2475 2628 2.814336 CACAGAGTTAAGAGGGCAAACC 59.186 50.00 0.0 0.0 40.67 3.27 R
3777 3936 4.389374 TGGTTTCTTTTCTCGATGCTTCT 58.611 39.13 0.0 0.0 0.00 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
611 612 7.169308 CGTGTGATACTGGATTATTCTACCAAC 59.831 40.741 0.00 0.0 33.14 3.77
2475 2628 1.421485 GCATTCAGCAAGGTCGTCG 59.579 57.895 0.00 0.0 44.79 5.12
3143 3302 3.060363 CACTCGTAAGTCGTAATGCAACC 59.940 47.826 0.00 0.0 40.80 3.77
3776 3935 1.749063 GGTAAAAGAATCCAAGGCCGG 59.251 52.381 0.00 0.0 0.00 6.13
3777 3936 2.619590 GGTAAAAGAATCCAAGGCCGGA 60.620 50.000 5.05 1.4 40.07 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 0.469070 CCAGCTTCCCCATCTCTCAG 59.531 60.000 0.0 0.0 0.00 3.35
137 138 8.519799 AAAAAGAACTTATTCTCAACCAGTCA 57.480 30.769 0.0 0.0 44.82 3.41
611 612 6.795399 ACAGGTGAAGTGAAACATAAAACTG 58.205 36.000 0.0 0.0 41.43 3.16
2475 2628 2.814336 CACAGAGTTAAGAGGGCAAACC 59.186 50.000 0.0 0.0 40.67 3.27
3776 3935 4.452455 TGGTTTCTTTTCTCGATGCTTCTC 59.548 41.667 0.0 0.0 0.00 2.87
3777 3936 4.389374 TGGTTTCTTTTCTCGATGCTTCT 58.611 39.130 0.0 0.0 0.00 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.