Multiple sequence alignment - TraesCS3A01G137700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G137700 chr3A 100.000 2255 0 0 1 2255 114697235 114694981 0.000000e+00 4165
1 TraesCS3A01G137700 chr2B 99.202 2255 17 1 1 2255 347064590 347062337 0.000000e+00 4063
2 TraesCS3A01G137700 chr6A 99.069 2255 17 1 1 2255 445769366 445771616 0.000000e+00 4045
3 TraesCS3A01G137700 chr6A 83.524 437 53 8 1823 2243 421100164 421100597 7.550000e-105 390
4 TraesCS3A01G137700 chr6A 84.362 243 25 8 1868 2098 171789008 171789249 2.250000e-55 226
5 TraesCS3A01G137700 chr2D 93.261 2018 80 12 283 2255 392363599 392361593 0.000000e+00 2922
6 TraesCS3A01G137700 chr2D 95.181 1328 37 11 1 1301 106676332 106675005 0.000000e+00 2073
7 TraesCS3A01G137700 chr2D 93.103 1189 45 4 1104 2255 106675011 106673823 0.000000e+00 1707
8 TraesCS3A01G137700 chr2D 89.717 389 28 1 1868 2244 186708244 186707856 9.360000e-134 486
9 TraesCS3A01G137700 chr2D 97.842 278 5 1 1 277 392364633 392364356 1.570000e-131 479
10 TraesCS3A01G137700 chr7B 94.683 1749 66 6 69 1792 119714360 119712614 0.000000e+00 2689
11 TraesCS3A01G137700 chr7B 91.793 1779 119 9 7 1767 584354296 584352527 0.000000e+00 2451
12 TraesCS3A01G137700 chr4D 92.711 1811 106 9 1 1792 100772822 100774625 0.000000e+00 2590
13 TraesCS3A01G137700 chr4D 92.769 1383 95 4 410 1792 448176682 448178059 0.000000e+00 1995
14 TraesCS3A01G137700 chr3D 93.001 1786 101 8 1 1767 595697330 595699110 0.000000e+00 2584
15 TraesCS3A01G137700 chr3D 90.428 982 64 10 1 963 29212644 29213614 0.000000e+00 1266
16 TraesCS3A01G137700 chr3D 88.689 389 32 3 1868 2244 512532076 512532464 4.390000e-127 464
17 TraesCS3A01G137700 chr1A 92.248 1793 108 10 1 1767 441748067 441749854 0.000000e+00 2512
18 TraesCS3A01G137700 chr3B 91.433 1786 109 8 1 1767 143538964 143540724 0.000000e+00 2410
19 TraesCS3A01G137700 chr7D 91.539 981 62 8 1 963 534461515 534462492 0.000000e+00 1332
20 TraesCS3A01G137700 chr5D 91.003 389 22 3 1868 2244 314889519 314889132 1.540000e-141 512
21 TraesCS3A01G137700 chr5D 90.415 386 25 1 1871 2244 332125198 332124813 4.330000e-137 497
22 TraesCS3A01G137700 chr6D 88.063 444 28 7 1826 2244 127393069 127393512 9.300000e-139 503
23 TraesCS3A01G137700 chr2A 89.717 389 28 3 1868 2244 71455906 71455518 9.360000e-134 486
24 TraesCS3A01G137700 chr2A 83.333 378 49 7 1868 2232 487378298 487377922 9.980000e-89 337
25 TraesCS3A01G137700 chr1D 89.717 389 26 4 1868 2244 205132274 205132660 3.370000e-133 484


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G137700 chr3A 114694981 114697235 2254 True 4165.0 4165 100.0000 1 2255 1 chr3A.!!$R1 2254
1 TraesCS3A01G137700 chr2B 347062337 347064590 2253 True 4063.0 4063 99.2020 1 2255 1 chr2B.!!$R1 2254
2 TraesCS3A01G137700 chr6A 445769366 445771616 2250 False 4045.0 4045 99.0690 1 2255 1 chr6A.!!$F3 2254
3 TraesCS3A01G137700 chr2D 106673823 106676332 2509 True 1890.0 2073 94.1420 1 2255 2 chr2D.!!$R2 2254
4 TraesCS3A01G137700 chr2D 392361593 392364633 3040 True 1700.5 2922 95.5515 1 2255 2 chr2D.!!$R3 2254
5 TraesCS3A01G137700 chr7B 119712614 119714360 1746 True 2689.0 2689 94.6830 69 1792 1 chr7B.!!$R1 1723
6 TraesCS3A01G137700 chr7B 584352527 584354296 1769 True 2451.0 2451 91.7930 7 1767 1 chr7B.!!$R2 1760
7 TraesCS3A01G137700 chr4D 100772822 100774625 1803 False 2590.0 2590 92.7110 1 1792 1 chr4D.!!$F1 1791
8 TraesCS3A01G137700 chr4D 448176682 448178059 1377 False 1995.0 1995 92.7690 410 1792 1 chr4D.!!$F2 1382
9 TraesCS3A01G137700 chr3D 595697330 595699110 1780 False 2584.0 2584 93.0010 1 1767 1 chr3D.!!$F3 1766
10 TraesCS3A01G137700 chr3D 29212644 29213614 970 False 1266.0 1266 90.4280 1 963 1 chr3D.!!$F1 962
11 TraesCS3A01G137700 chr1A 441748067 441749854 1787 False 2512.0 2512 92.2480 1 1767 1 chr1A.!!$F1 1766
12 TraesCS3A01G137700 chr3B 143538964 143540724 1760 False 2410.0 2410 91.4330 1 1767 1 chr3B.!!$F1 1766
13 TraesCS3A01G137700 chr7D 534461515 534462492 977 False 1332.0 1332 91.5390 1 963 1 chr7D.!!$F1 962

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
525 1284 0.253044 GGCAGTAGGTCATGCTTGGA 59.747 55.0 0.0 0.0 42.19 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1996 3039 1.153706 CGACGTTACCTTGGGCGAT 60.154 57.895 0.0 0.0 0.0 4.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 205 1.872773 ACTCCAATCTCCAGAGTCCC 58.127 55.0 0.0 0.0 36.06 4.46
525 1284 0.253044 GGCAGTAGGTCATGCTTGGA 59.747 55.0 0.0 0.0 42.19 3.53
626 1396 1.745232 GACAACAACACACCACTCCA 58.255 50.0 0.0 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 4.503991 GCCTTTAGCCATAGTCTGCAGTAT 60.504 45.833 14.67 6.13 34.35 2.12
202 205 3.861840 TGGACTAAGAAAGAAGCATCCG 58.138 45.455 0.00 0.00 0.00 4.18
626 1396 6.751888 GCGAAACATGAGCCAAAATAACTTAT 59.248 34.615 0.00 0.00 0.00 1.73
1996 3039 1.153706 CGACGTTACCTTGGGCGAT 60.154 57.895 0.00 0.00 0.00 4.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.