Multiple sequence alignment - TraesCS3A01G130900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G130900 chr3A 100.000 2450 0 0 1 2450 107654745 107652296 0.000000e+00 4525.0
1 TraesCS3A01G130900 chr7D 94.199 1586 65 9 873 2450 268962103 268963669 0.000000e+00 2394.0
2 TraesCS3A01G130900 chr7D 83.760 1447 189 25 877 2301 607889189 607890611 0.000000e+00 1328.0
3 TraesCS3A01G130900 chr7D 83.425 1460 188 27 877 2307 609988711 609987277 0.000000e+00 1306.0
4 TraesCS3A01G130900 chr7D 92.688 465 24 5 296 757 268939427 268939884 0.000000e+00 662.0
5 TraesCS3A01G130900 chr7D 87.055 309 25 5 2 296 268939081 268939388 3.900000e-88 335.0
6 TraesCS3A01G130900 chr7D 74.603 315 58 12 2 300 80315383 80315691 4.280000e-23 119.0
7 TraesCS3A01G130900 chr7D 97.101 69 1 1 760 828 268962053 268962120 5.540000e-22 115.0
8 TraesCS3A01G130900 chr7D 93.548 62 4 0 1879 1940 113608210 113608271 2.590000e-15 93.5
9 TraesCS3A01G130900 chr6A 98.631 1096 15 0 1355 2450 27557757 27558852 0.000000e+00 1941.0
10 TraesCS3A01G130900 chr6A 95.477 818 27 5 1 811 27550829 27551643 0.000000e+00 1297.0
11 TraesCS3A01G130900 chr6A 95.179 560 11 5 807 1352 27551843 27552400 0.000000e+00 870.0
12 TraesCS3A01G130900 chr6D 93.232 990 49 11 876 1853 28126218 28125235 0.000000e+00 1441.0
13 TraesCS3A01G130900 chr6D 93.143 525 26 7 308 828 28126722 28126204 0.000000e+00 761.0
14 TraesCS3A01G130900 chr6D 93.438 320 12 3 2139 2450 28125008 28124690 1.330000e-127 466.0
15 TraesCS3A01G130900 chr6D 87.500 312 24 4 2 299 28127084 28126774 1.800000e-91 346.0
16 TraesCS3A01G130900 chr6D 97.143 105 3 0 1851 1955 28125112 28125008 6.960000e-41 178.0
17 TraesCS3A01G130900 chr7B 83.987 1249 151 32 1076 2301 696920658 696921880 0.000000e+00 1153.0
18 TraesCS3A01G130900 chr7B 95.596 545 16 5 1204 1741 99737573 99737030 0.000000e+00 867.0
19 TraesCS3A01G130900 chr7B 93.346 541 27 6 299 838 99804543 99804011 0.000000e+00 791.0
20 TraesCS3A01G130900 chr7B 91.597 357 26 3 852 1208 99804024 99803672 7.870000e-135 490.0
21 TraesCS3A01G130900 chr7B 89.116 294 16 4 21 299 99804874 99804582 3.880000e-93 351.0
22 TraesCS3A01G130900 chr7B 100.000 38 0 0 1678 1715 99737030 99736993 1.220000e-08 71.3
23 TraesCS3A01G130900 chr2B 80.295 949 145 21 877 1805 443349600 443348674 0.000000e+00 678.0
24 TraesCS3A01G130900 chr1D 79.641 334 46 13 299 618 291097954 291097629 1.140000e-53 220.0
25 TraesCS3A01G130900 chr2D 78.338 337 46 14 299 619 246548867 246548542 2.490000e-45 193.0
26 TraesCS3A01G130900 chr2D 77.581 339 48 18 299 617 246622650 246622320 1.940000e-41 180.0
27 TraesCS3A01G130900 chr6B 77.743 319 45 18 2 300 347585689 347585377 3.240000e-39 172.0
28 TraesCS3A01G130900 chr6B 82.906 117 11 8 24 139 54239587 54239479 2.010000e-16 97.1
29 TraesCS3A01G130900 chr4D 93.671 79 5 0 2371 2449 503275102 503275180 4.280000e-23 119.0
30 TraesCS3A01G130900 chr3D 89.011 91 9 1 2361 2450 29796436 29796346 7.160000e-21 111.0
31 TraesCS3A01G130900 chr1A 92.208 77 6 0 2374 2450 469392666 469392742 2.580000e-20 110.0
32 TraesCS3A01G130900 chr1B 97.368 38 1 0 1904 1941 534904770 534904807 5.650000e-07 65.8
33 TraesCS3A01G130900 chr1B 97.368 38 1 0 1904 1941 534925206 534925243 5.650000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G130900 chr3A 107652296 107654745 2449 True 4525.00 4525 100.0000 1 2450 1 chr3A.!!$R1 2449
1 TraesCS3A01G130900 chr7D 607889189 607890611 1422 False 1328.00 1328 83.7600 877 2301 1 chr7D.!!$F3 1424
2 TraesCS3A01G130900 chr7D 609987277 609988711 1434 True 1306.00 1306 83.4250 877 2307 1 chr7D.!!$R1 1430
3 TraesCS3A01G130900 chr7D 268962053 268963669 1616 False 1254.50 2394 95.6500 760 2450 2 chr7D.!!$F5 1690
4 TraesCS3A01G130900 chr7D 268939081 268939884 803 False 498.50 662 89.8715 2 757 2 chr7D.!!$F4 755
5 TraesCS3A01G130900 chr6A 27557757 27558852 1095 False 1941.00 1941 98.6310 1355 2450 1 chr6A.!!$F1 1095
6 TraesCS3A01G130900 chr6A 27550829 27552400 1571 False 1083.50 1297 95.3280 1 1352 2 chr6A.!!$F2 1351
7 TraesCS3A01G130900 chr6D 28124690 28127084 2394 True 638.40 1441 92.8912 2 2450 5 chr6D.!!$R1 2448
8 TraesCS3A01G130900 chr7B 696920658 696921880 1222 False 1153.00 1153 83.9870 1076 2301 1 chr7B.!!$F1 1225
9 TraesCS3A01G130900 chr7B 99803672 99804874 1202 True 544.00 791 91.3530 21 1208 3 chr7B.!!$R2 1187
10 TraesCS3A01G130900 chr7B 99736993 99737573 580 True 469.15 867 97.7980 1204 1741 2 chr7B.!!$R1 537
11 TraesCS3A01G130900 chr2B 443348674 443349600 926 True 678.00 678 80.2950 877 1805 1 chr2B.!!$R1 928

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
393 456 0.549469 ACCTCTTCCCGTGGTGTTTT 59.451 50.0 0.0 0.0 38.06 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2068 2547 5.183522 TCTCTGCAGCAGATCTATCATGTAG 59.816 44.0 25.59 9.33 39.92 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 215 7.815398 TGCTATTTTGCTTTGTTATGTGATG 57.185 32.000 0.0 0.0 0.00 3.07
198 216 6.310956 TGCTATTTTGCTTTGTTATGTGATGC 59.689 34.615 0.0 0.0 0.00 3.91
255 273 3.562557 TGTAAACTTTTCGCCTCTTCCAC 59.437 43.478 0.0 0.0 0.00 4.02
393 456 0.549469 ACCTCTTCCCGTGGTGTTTT 59.451 50.000 0.0 0.0 38.06 2.43
835 1110 4.527509 TCACTCTCTCAATCAACCACTC 57.472 45.455 0.0 0.0 0.00 3.51
874 1153 8.614469 AAAATCAACCACTCAAAAGAAAAACA 57.386 26.923 0.0 0.0 0.00 2.83
879 1160 7.545265 TCAACCACTCAAAAGAAAAACATTCAG 59.455 33.333 0.0 0.0 0.00 3.02
965 1246 1.338136 CCTATCCCCTCCACTGCGTT 61.338 60.000 0.0 0.0 0.00 4.84
1088 1390 0.390492 CGATCTGCTGCCATCCACTA 59.610 55.000 0.0 0.0 0.00 2.74
1291 1602 0.041312 CGTTCAAAACAGGGCTCGTG 60.041 55.000 0.0 0.0 0.00 4.35
1773 2126 0.609131 ACAGGCAAAATCAGGGACCG 60.609 55.000 0.0 0.0 0.00 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 215 5.410067 ACATAATAATGTGCAAGTTGTGGC 58.590 37.500 4.48 0.00 44.79 5.01
198 216 6.867816 ACAACATAATAATGTGCAAGTTGTGG 59.132 34.615 4.48 0.00 45.79 4.17
203 221 9.973450 TTGTTTACAACATAATAATGTGCAAGT 57.027 25.926 0.00 0.00 45.79 3.16
244 262 1.444553 GTCGTCAGTGGAAGAGGCG 60.445 63.158 0.00 0.00 32.07 5.52
255 273 0.865111 TTCCAACGCAATGTCGTCAG 59.135 50.000 3.54 1.05 42.46 3.51
393 456 3.428452 CGTAACAATGAAGGAGCGGACTA 60.428 47.826 0.00 0.00 0.00 2.59
650 722 2.622436 GCGAGCCTCAAACTGTCTATT 58.378 47.619 0.00 0.00 0.00 1.73
651 723 1.134670 GGCGAGCCTCAAACTGTCTAT 60.135 52.381 6.90 0.00 0.00 1.98
874 1153 3.068024 GGCTCGAGATTGAGAGACTGAAT 59.932 47.826 18.75 0.00 39.36 2.57
879 1160 2.687935 AGAAGGCTCGAGATTGAGAGAC 59.312 50.000 18.75 0.00 42.67 3.36
1773 2126 5.371526 TGCATTGGTAAGAGATGATCCTTC 58.628 41.667 0.47 0.00 0.00 3.46
2068 2547 5.183522 TCTCTGCAGCAGATCTATCATGTAG 59.816 44.000 25.59 9.33 39.92 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.