Multiple sequence alignment - TraesCS3A01G118100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G118100 chr3A 100.000 3214 0 0 1 3214 89666092 89669305 0.000000e+00 5936
1 TraesCS3A01G118100 chr3A 97.291 3248 54 13 1 3214 89577878 89581125 0.000000e+00 5480
2 TraesCS3A01G118100 chr3D 96.148 2726 89 9 1 2718 75544187 75546904 0.000000e+00 4438
3 TraesCS3A01G118100 chr3D 87.957 465 36 4 2762 3214 75547059 75547515 6.100000e-147 531
4 TraesCS3A01G118100 chr3D 83.972 574 65 14 2661 3214 75667388 75667954 2.840000e-145 525
5 TraesCS3A01G118100 chr3B 95.788 2564 97 6 1 2559 121641791 121644348 0.000000e+00 4126
6 TraesCS3A01G118100 chr3B 89.706 680 49 11 2551 3214 121647590 121648264 0.000000e+00 848
7 TraesCS3A01G118100 chr3B 81.898 453 61 12 2775 3214 122324409 122324853 2.360000e-96 363
8 TraesCS3A01G118100 chr5D 80.137 1314 227 26 959 2249 535643664 535644966 0.000000e+00 950
9 TraesCS3A01G118100 chr5D 89.058 329 26 6 172 492 535861919 535862245 1.800000e-107 399
10 TraesCS3A01G118100 chr5D 78.873 426 82 8 1390 1813 499069513 499069094 6.790000e-72 281
11 TraesCS3A01G118100 chr5D 82.479 234 36 4 1999 2228 535817793 535818025 1.960000e-47 200
12 TraesCS3A01G118100 chr5B 80.030 1327 217 31 959 2249 676251104 676252418 0.000000e+00 939
13 TraesCS3A01G118100 chr5B 78.621 1291 212 42 958 2220 676242499 676243753 0.000000e+00 797
14 TraesCS3A01G118100 chr5B 83.594 512 62 13 5 497 676271702 676272210 8.120000e-126 460
15 TraesCS3A01G118100 chr5B 79.483 580 81 18 1 555 676241225 676241791 8.420000e-101 377
16 TraesCS3A01G118100 chr5B 77.598 433 82 15 1390 1816 619112796 619112373 6.890000e-62 248
17 TraesCS3A01G118100 chr5B 76.815 427 89 10 1390 1813 619156587 619156168 6.930000e-57 231
18 TraesCS3A01G118100 chr5B 76.923 429 84 12 1390 1813 619279442 619279024 2.490000e-56 230
19 TraesCS3A01G118100 chr4A 80.061 1319 217 32 959 2248 636314976 636313675 0.000000e+00 937
20 TraesCS3A01G118100 chr4A 77.875 1487 277 42 726 2182 635960942 635959478 0.000000e+00 876
21 TraesCS3A01G118100 chr4A 81.113 773 123 20 718 1478 636044030 636043269 5.930000e-167 597
22 TraesCS3A01G118100 chr4A 86.193 507 55 11 5 501 635961641 635961140 4.720000e-148 534
23 TraesCS3A01G118100 chr4A 85.270 482 51 12 37 501 636044695 636044217 2.240000e-131 479
24 TraesCS3A01G118100 chr4A 82.290 559 70 20 7 545 636261219 636260670 1.050000e-124 457
25 TraesCS3A01G118100 chr4A 72.492 927 203 41 1343 2239 636034728 636033824 5.320000e-63 252
26 TraesCS3A01G118100 chr4A 83.920 199 30 2 1999 2196 636083575 636083378 4.230000e-44 189
27 TraesCS3A01G118100 chr4A 79.528 254 40 12 1999 2245 636100018 636099770 1.530000e-38 171
28 TraesCS3A01G118100 chrUn 79.154 331 65 4 1390 1718 334690501 334690829 3.230000e-55 226


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G118100 chr3A 89666092 89669305 3213 False 5936.0 5936 100.0000 1 3214 1 chr3A.!!$F2 3213
1 TraesCS3A01G118100 chr3A 89577878 89581125 3247 False 5480.0 5480 97.2910 1 3214 1 chr3A.!!$F1 3213
2 TraesCS3A01G118100 chr3D 75544187 75547515 3328 False 2484.5 4438 92.0525 1 3214 2 chr3D.!!$F2 3213
3 TraesCS3A01G118100 chr3D 75667388 75667954 566 False 525.0 525 83.9720 2661 3214 1 chr3D.!!$F1 553
4 TraesCS3A01G118100 chr3B 121641791 121648264 6473 False 2487.0 4126 92.7470 1 3214 2 chr3B.!!$F2 3213
5 TraesCS3A01G118100 chr5D 535643664 535644966 1302 False 950.0 950 80.1370 959 2249 1 chr5D.!!$F1 1290
6 TraesCS3A01G118100 chr5B 676251104 676252418 1314 False 939.0 939 80.0300 959 2249 1 chr5B.!!$F1 1290
7 TraesCS3A01G118100 chr5B 676241225 676243753 2528 False 587.0 797 79.0520 1 2220 2 chr5B.!!$F3 2219
8 TraesCS3A01G118100 chr5B 676271702 676272210 508 False 460.0 460 83.5940 5 497 1 chr5B.!!$F2 492
9 TraesCS3A01G118100 chr4A 636313675 636314976 1301 True 937.0 937 80.0610 959 2248 1 chr4A.!!$R5 1289
10 TraesCS3A01G118100 chr4A 635959478 635961641 2163 True 705.0 876 82.0340 5 2182 2 chr4A.!!$R6 2177
11 TraesCS3A01G118100 chr4A 636043269 636044695 1426 True 538.0 597 83.1915 37 1478 2 chr4A.!!$R7 1441
12 TraesCS3A01G118100 chr4A 636260670 636261219 549 True 457.0 457 82.2900 7 545 1 chr4A.!!$R4 538
13 TraesCS3A01G118100 chr4A 636033824 636034728 904 True 252.0 252 72.4920 1343 2239 1 chr4A.!!$R1 896

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
626 824 7.548427 CCATGCACTATCTAAATATCCACTGAG 59.452 40.741 0.0 0.0 0.0 3.35 F
1913 2348 6.320672 AGAAATTCTATCTCATGGCAAACTGG 59.679 38.462 0.0 0.0 0.0 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1933 2368 0.881796 GAGGCCAAAGCTGTACAACC 59.118 55.000 5.01 0.0 39.73 3.77 R
3038 6875 2.492090 GCAGATCCGAGACGCACT 59.508 61.111 0.00 0.0 0.00 4.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
626 824 7.548427 CCATGCACTATCTAAATATCCACTGAG 59.452 40.741 0.00 0.0 0.00 3.35
1913 2348 6.320672 AGAAATTCTATCTCATGGCAAACTGG 59.679 38.462 0.00 0.0 0.00 4.00
1933 2368 2.035632 GGTACTGGATGAGGAGACAGG 58.964 57.143 0.00 0.0 35.34 4.00
2079 2523 0.391130 GCACACATTCAGCGGGTCTA 60.391 55.000 0.00 0.0 0.00 2.59
2296 2748 1.272092 TGCAGCAGCCAGGAAGTTTAT 60.272 47.619 0.00 0.0 41.13 1.40
2652 6359 2.238395 TCATCCGTCCCAATGATCACAA 59.762 45.455 0.00 0.0 0.00 3.33
2825 6660 1.228552 ATGTCCTTGTTGCCGCCTT 60.229 52.632 0.00 0.0 0.00 4.35
2859 6694 3.272364 AAAGCCTGGCCAGCATCGA 62.272 57.895 28.39 0.0 0.00 3.59
2883 6719 2.529389 AGGGGTGCCTTCCTTCGT 60.529 61.111 0.00 0.0 0.00 3.85
3038 6875 1.462043 ATCGGCAGGGATGGGATGA 60.462 57.895 0.00 0.0 0.00 2.92
3122 6960 4.182433 TTGTCGCTGGTGGTGGCA 62.182 61.111 0.00 0.0 38.36 4.92
3166 7004 2.561419 CCTAGTCTTGGACTCCGACAAA 59.439 50.000 3.32 0.0 42.40 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
265 290 7.719778 TTACCTTTAGAAAGAAACGACTTCC 57.280 36.000 3.52 0.0 38.28 3.46
323 353 6.560253 TGAAGCTTATCAGAAACTTGAACC 57.440 37.500 0.00 0.0 0.00 3.62
626 824 5.228220 CGATGACTAAAAGAGACGACACATC 59.772 44.000 0.00 0.0 0.00 3.06
1913 2348 2.035632 CCTGTCTCCTCATCCAGTACC 58.964 57.143 0.00 0.0 0.00 3.34
1933 2368 0.881796 GAGGCCAAAGCTGTACAACC 59.118 55.000 5.01 0.0 39.73 3.77
2079 2523 1.072678 CATCGCATCCCTCCAGCAT 59.927 57.895 0.00 0.0 0.00 3.79
2296 2748 2.354729 CGGACAATGCCCAGGGAA 59.645 61.111 10.89 0.0 0.00 3.97
2652 6359 2.166664 CGAAAAGAAGAGGGACGATCCT 59.833 50.000 0.00 0.0 40.43 3.24
2691 6399 4.556699 GCTTAAGCACTTCACAAATCCGTT 60.557 41.667 22.59 0.0 41.59 4.44
2741 6461 4.000557 GCGCTCGTGTGTGTGTGG 62.001 66.667 0.00 0.0 0.00 4.17
2743 6463 4.522689 TGGCGCTCGTGTGTGTGT 62.523 61.111 7.64 0.0 0.00 3.72
2859 6694 2.526873 AAGGCACCCCTCTGTCGT 60.527 61.111 0.00 0.0 41.90 4.34
3038 6875 2.492090 GCAGATCCGAGACGCACT 59.508 61.111 0.00 0.0 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.