Multiple sequence alignment - TraesCS3A01G115300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G115300 chr3A 100.000 2663 0 0 1 2663 83033132 83030470 0.000000e+00 4918
1 TraesCS3A01G115300 chr3A 96.860 2675 47 18 1 2663 42788378 42785729 0.000000e+00 4440
2 TraesCS3A01G115300 chr3A 95.007 2704 77 20 1 2663 450960336 450963022 0.000000e+00 4193
3 TraesCS3A01G115300 chr3A 93.956 1307 34 14 1394 2663 653945723 653947021 0.000000e+00 1934
4 TraesCS3A01G115300 chr3A 92.490 1052 32 17 1651 2663 745761378 745762421 0.000000e+00 1461
5 TraesCS3A01G115300 chr3A 92.143 420 24 6 2247 2663 711572437 711572024 3.820000e-163 584
6 TraesCS3A01G115300 chr2A 93.732 2728 86 26 1 2663 619878127 619875420 0.000000e+00 4012
7 TraesCS3A01G115300 chr2A 91.667 420 25 7 2247 2663 733076189 733076601 8.270000e-160 573
8 TraesCS3A01G115300 chr2A 91.429 420 27 6 2247 2663 614223830 614224243 3.850000e-158 568
9 TraesCS3A01G115300 chr1D 92.055 2681 145 36 1 2663 466342915 466340285 0.000000e+00 3709
10 TraesCS3A01G115300 chr2D 91.830 2705 152 42 1 2663 536211806 536214483 0.000000e+00 3707
11 TraesCS3A01G115300 chr5D 91.875 2683 154 35 1 2663 65968170 65970808 0.000000e+00 3688
12 TraesCS3A01G115300 chr4D 91.682 2705 157 45 1 2663 65873178 65870500 0.000000e+00 3687
13 TraesCS3A01G115300 chr1B 90.577 2685 210 32 1 2663 588837017 588834354 0.000000e+00 3517
14 TraesCS3A01G115300 chr5B 90.429 2706 187 44 1 2663 12559386 12562062 0.000000e+00 3496
15 TraesCS3A01G115300 chr3B 90.170 2706 199 43 1 2663 177749497 177752178 0.000000e+00 3461
16 TraesCS3A01G115300 chr5A 93.299 2343 124 18 1 2326 169180627 169178301 0.000000e+00 3426
17 TraesCS3A01G115300 chr6B 91.224 2279 151 36 1 2258 680522653 680520403 0.000000e+00 3055
18 TraesCS3A01G115300 chr2B 90.016 1863 145 30 819 2663 747117432 747115593 0.000000e+00 2372


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G115300 chr3A 83030470 83033132 2662 True 4918 4918 100.000 1 2663 1 chr3A.!!$R2 2662
1 TraesCS3A01G115300 chr3A 42785729 42788378 2649 True 4440 4440 96.860 1 2663 1 chr3A.!!$R1 2662
2 TraesCS3A01G115300 chr3A 450960336 450963022 2686 False 4193 4193 95.007 1 2663 1 chr3A.!!$F1 2662
3 TraesCS3A01G115300 chr3A 653945723 653947021 1298 False 1934 1934 93.956 1394 2663 1 chr3A.!!$F2 1269
4 TraesCS3A01G115300 chr3A 745761378 745762421 1043 False 1461 1461 92.490 1651 2663 1 chr3A.!!$F3 1012
5 TraesCS3A01G115300 chr2A 619875420 619878127 2707 True 4012 4012 93.732 1 2663 1 chr2A.!!$R1 2662
6 TraesCS3A01G115300 chr1D 466340285 466342915 2630 True 3709 3709 92.055 1 2663 1 chr1D.!!$R1 2662
7 TraesCS3A01G115300 chr2D 536211806 536214483 2677 False 3707 3707 91.830 1 2663 1 chr2D.!!$F1 2662
8 TraesCS3A01G115300 chr5D 65968170 65970808 2638 False 3688 3688 91.875 1 2663 1 chr5D.!!$F1 2662
9 TraesCS3A01G115300 chr4D 65870500 65873178 2678 True 3687 3687 91.682 1 2663 1 chr4D.!!$R1 2662
10 TraesCS3A01G115300 chr1B 588834354 588837017 2663 True 3517 3517 90.577 1 2663 1 chr1B.!!$R1 2662
11 TraesCS3A01G115300 chr5B 12559386 12562062 2676 False 3496 3496 90.429 1 2663 1 chr5B.!!$F1 2662
12 TraesCS3A01G115300 chr3B 177749497 177752178 2681 False 3461 3461 90.170 1 2663 1 chr3B.!!$F1 2662
13 TraesCS3A01G115300 chr5A 169178301 169180627 2326 True 3426 3426 93.299 1 2326 1 chr5A.!!$R1 2325
14 TraesCS3A01G115300 chr6B 680520403 680522653 2250 True 3055 3055 91.224 1 2258 1 chr6B.!!$R1 2257
15 TraesCS3A01G115300 chr2B 747115593 747117432 1839 True 2372 2372 90.016 819 2663 1 chr2B.!!$R1 1844

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
659 669 0.111266 CGCACGCTGTGTTAGTTCAC 60.111 55.0 9.76 0.0 35.75 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2314 2456 0.600518 TGGCGCGTAAGTAGTTGCAA 60.601 50.0 8.43 0.0 41.68 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 91 3.334054 AGGCAAGGGTGGAGGAGC 61.334 66.667 0.00 0.0 0.00 4.70
427 432 4.202050 CCACCTGAACAAGTCCAAGAAAAG 60.202 45.833 0.00 0.0 0.00 2.27
659 669 0.111266 CGCACGCTGTGTTAGTTCAC 60.111 55.000 9.76 0.0 35.75 3.18
667 678 3.303725 GCTGTGTTAGTTCACGCATCAAA 60.304 43.478 0.00 0.0 40.74 2.69
686 697 8.616076 GCATCAAAGATAACACAGCTAACTTAT 58.384 33.333 0.00 0.0 0.00 1.73
797 808 1.229359 CATGCTCCTCCCAATGGCT 59.771 57.895 0.00 0.0 0.00 4.75
944 960 1.265635 TGCGCATGTTGTGTTAGTTCC 59.734 47.619 5.66 0.0 0.00 3.62
950 966 4.155826 GCATGTTGTGTTAGTTCCAGCATA 59.844 41.667 0.00 0.0 30.32 3.14
982 998 2.752903 ACACAACTGACTTGTTTGTCCC 59.247 45.455 0.00 0.0 41.50 4.46
984 1000 2.014128 CAACTGACTTGTTTGTCCCGT 58.986 47.619 0.00 0.0 36.21 5.28
1130 1149 5.367945 AGTACCTTCACTGACTCCAAAAA 57.632 39.130 0.00 0.0 0.00 1.94
1462 1489 1.471684 GTGATCGTGACGGTCCTACTT 59.528 52.381 16.35 0.0 35.99 2.24
1659 1688 0.114364 TGTGTCCACAGAGGCTCCTA 59.886 55.000 11.71 0.0 36.21 2.94
2314 2456 3.156293 TGCAACTCATTATGTGCCACTT 58.844 40.909 0.00 0.0 0.00 3.16
2340 2504 1.868987 TACTTACGCGCCACTCTGCA 61.869 55.000 5.73 0.0 0.00 4.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 91 4.272504 ACAACACTCACACAAATAGGAACG 59.727 41.667 0.00 0.00 0.00 3.95
252 257 1.474330 GGAGGCATTTCATCCGGTTT 58.526 50.000 0.00 0.00 35.76 3.27
659 669 5.063944 AGTTAGCTGTGTTATCTTTGATGCG 59.936 40.000 0.00 0.00 0.00 4.73
797 808 1.260538 CCCTGAGTGCTGCCTGTAGA 61.261 60.000 0.00 0.00 0.00 2.59
841 853 0.778078 TTTGATGGGGAGTTGGGGGA 60.778 55.000 0.00 0.00 0.00 4.81
982 998 2.802816 GCATCACCTATAGGCAGAAACG 59.197 50.000 19.25 10.65 39.32 3.60
984 1000 2.777114 TGGCATCACCTATAGGCAGAAA 59.223 45.455 19.25 0.31 40.22 2.52
1343 1368 8.126074 CACAGTACATTTTTGTGCAACTAACTA 58.874 33.333 0.00 0.00 36.20 2.24
1441 1468 0.806868 GTAGGACCGTCACGATCACA 59.193 55.000 0.00 0.00 0.00 3.58
1659 1688 8.641498 AGTTACAAATGAGGAAACAGAATCAT 57.359 30.769 0.00 0.00 33.91 2.45
1868 1907 5.420725 TGTTGATACATTAGGAGCACTGT 57.579 39.130 0.00 0.00 0.00 3.55
2248 2304 6.070767 ACAGTAGGACATAAGTAGTTGCACAT 60.071 38.462 0.00 0.00 0.00 3.21
2314 2456 0.600518 TGGCGCGTAAGTAGTTGCAA 60.601 50.000 8.43 0.00 41.68 4.08
2384 2548 7.231722 AGACACAGTACTAGTCTTCAATCTGTT 59.768 37.037 19.22 0.67 39.45 3.16
2385 2549 6.717540 AGACACAGTACTAGTCTTCAATCTGT 59.282 38.462 19.22 1.91 39.45 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.