Multiple sequence alignment - TraesCS3A01G112500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G112500 chr3A 100.000 2767 0 0 1 2767 80083679 80080913 0.000000e+00 5110
1 TraesCS3A01G112500 chr5A 97.521 2703 49 9 65 2767 496335818 496333134 0.000000e+00 4604
2 TraesCS3A01G112500 chr5A 98.349 1514 25 0 1 1514 666132407 666133920 0.000000e+00 2658
3 TraesCS3A01G112500 chr5A 98.330 898 15 0 69 966 664889319 664888422 0.000000e+00 1576
4 TraesCS3A01G112500 chr5A 98.050 564 11 0 2204 2767 664887895 664887332 0.000000e+00 981
5 TraesCS3A01G112500 chr5A 97.345 565 14 1 2204 2767 666133970 666134534 0.000000e+00 959
6 TraesCS3A01G112500 chr5A 98.144 485 8 1 1031 1514 664888429 664887945 0.000000e+00 845
7 TraesCS3A01G112500 chr1D 94.831 2631 62 22 179 2767 404282251 404284849 0.000000e+00 4037
8 TraesCS3A01G112500 chr1D 97.980 99 2 0 79 177 404281988 404282086 3.660000e-39 172
9 TraesCS3A01G112500 chr7A 96.940 1438 32 4 77 1510 653015633 653014204 0.000000e+00 2401
10 TraesCS3A01G112500 chr7A 93.855 830 12 4 1956 2767 653011536 653010728 0.000000e+00 1214
11 TraesCS3A01G112500 chr7A 97.639 466 10 1 1503 1968 653013828 653013364 0.000000e+00 798
12 TraesCS3A01G112500 chr7A 84.925 199 19 7 2222 2416 145766834 145766643 1.010000e-44 191
13 TraesCS3A01G112500 chr7A 83.333 222 19 10 2199 2416 119582700 119582493 3.640000e-44 189
14 TraesCS3A01G112500 chr7A 89.922 129 12 1 2056 2183 119582966 119582838 6.130000e-37 165
15 TraesCS3A01G112500 chr7A 90.476 126 11 1 2056 2180 458689454 458689329 6.130000e-37 165
16 TraesCS3A01G112500 chr7A 82.178 202 22 9 2199 2396 458689191 458689000 7.930000e-36 161
17 TraesCS3A01G112500 chrUn 98.293 410 7 0 1037 1446 477751036 477751445 0.000000e+00 719
18 TraesCS3A01G112500 chr5B 82.069 290 46 5 36 322 231110346 231110060 2.750000e-60 243
19 TraesCS3A01G112500 chr4A 81.685 273 48 2 67 337 148888075 148888347 2.770000e-55 226
20 TraesCS3A01G112500 chr3D 84.804 204 26 2 1812 2010 270460054 270460257 1.680000e-47 200
21 TraesCS3A01G112500 chr3D 85.279 197 18 7 2222 2414 270460544 270460733 2.810000e-45 193
22 TraesCS3A01G112500 chr3D 92.063 126 8 2 2056 2180 270460267 270460391 2.830000e-40 176
23 TraesCS3A01G112500 chr7D 83.616 177 27 2 80 255 111043304 111043129 6.130000e-37 165


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G112500 chr3A 80080913 80083679 2766 True 5110.0 5110 100.000000 1 2767 1 chr3A.!!$R1 2766
1 TraesCS3A01G112500 chr5A 496333134 496335818 2684 True 4604.0 4604 97.521000 65 2767 1 chr5A.!!$R1 2702
2 TraesCS3A01G112500 chr5A 666132407 666134534 2127 False 1808.5 2658 97.847000 1 2767 2 chr5A.!!$F1 2766
3 TraesCS3A01G112500 chr5A 664887332 664889319 1987 True 1134.0 1576 98.174667 69 2767 3 chr5A.!!$R2 2698
4 TraesCS3A01G112500 chr1D 404281988 404284849 2861 False 2104.5 4037 96.405500 79 2767 2 chr1D.!!$F1 2688
5 TraesCS3A01G112500 chr7A 653010728 653015633 4905 True 1471.0 2401 96.144667 77 2767 3 chr7A.!!$R4 2690

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
534 705 7.439356 TGCTAAGTATGCTTTCATGACTACATC 59.561 37.037 0.00 0.0 36.22 3.06 F
1228 1414 2.126346 GTTTGTGCATGCGGCCTC 60.126 61.111 14.09 0.0 43.89 4.70 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1547 2134 1.538666 AAGGTCTGCAGCCTTGGTT 59.461 52.632 29.80 14.44 44.01 3.67 R
2639 5098 8.840833 AACCAAAATTTTACCCATAACATGTC 57.159 30.769 2.44 0.00 0.00 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
534 705 7.439356 TGCTAAGTATGCTTTCATGACTACATC 59.561 37.037 0.00 0.0 36.22 3.06
1098 1281 4.947388 TGTTGAAACTTGAAAGGCTACTGT 59.053 37.500 0.00 0.0 0.00 3.55
1228 1414 2.126346 GTTTGTGCATGCGGCCTC 60.126 61.111 14.09 0.0 43.89 4.70
1351 1542 9.401058 CAATTTGTCCTATTCTGGATTTAGAGT 57.599 33.333 0.00 0.0 38.52 3.24
1547 2134 7.680730 AGTCTAAAGAAAAGGCATCTACTTCA 58.319 34.615 0.00 0.0 0.00 3.02
1686 2273 0.034896 AAGCGGAAGTTCGACCATGT 59.965 50.000 0.00 0.0 0.00 3.21
2229 4680 2.039084 ACCGCCTCAAGAGTCAAGATTT 59.961 45.455 0.00 0.0 0.00 2.17
2748 5207 8.517056 GGAAAAGTCTAACCGATCCATTAAAAA 58.483 33.333 0.00 0.0 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 9.913310 CTCTCTCTCTCTCTCTCTCTCTATATA 57.087 40.741 0.00 0.00 0.00 0.86
43 44 7.990055 TCTCTCTCTCTCTCTCTCTCTCTATA 58.010 42.308 0.00 0.00 0.00 1.31
45 46 6.101881 TCTCTCTCTCTCTCTCTCTCTCTCTA 59.898 46.154 0.00 0.00 0.00 2.43
426 590 3.315191 GCCGAACCATTTGTAGTGCATAT 59.685 43.478 0.00 0.00 0.00 1.78
534 705 9.395707 CACTAAGTCTAGCCTATAATAACAACG 57.604 37.037 0.00 0.00 0.00 4.10
631 803 3.325870 TCACAGATCCGAACAATGTGTC 58.674 45.455 8.36 0.00 41.50 3.67
1351 1542 2.294979 TCGAGCCTCTATAGAACGCAA 58.705 47.619 18.81 5.97 0.00 4.85
1547 2134 1.538666 AAGGTCTGCAGCCTTGGTT 59.461 52.632 29.80 14.44 44.01 3.67
1686 2273 3.774766 TCTTCAGCCCTAGCAATACTCAA 59.225 43.478 0.00 0.00 43.56 3.02
2229 4680 9.367444 GTGCTAGTACTTTCTATTTCTTTAGCA 57.633 33.333 0.00 2.07 37.89 3.49
2639 5098 8.840833 AACCAAAATTTTACCCATAACATGTC 57.159 30.769 2.44 0.00 0.00 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.