Multiple sequence alignment - TraesCS3A01G099900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G099900 chr3A 100.000 2465 0 0 1 2465 64316759 64314295 0.000000e+00 4553
1 TraesCS3A01G099900 chr3A 95.153 1238 26 10 1262 2465 674547419 674546182 0.000000e+00 1923
2 TraesCS3A01G099900 chr5A 96.163 2502 33 17 1 2465 602497645 602500120 0.000000e+00 4030
3 TraesCS3A01G099900 chr5A 94.959 1706 38 26 797 2465 513857969 513859663 0.000000e+00 2630
4 TraesCS3A01G099900 chr5A 93.179 1642 68 13 845 2465 562131924 562133542 0.000000e+00 2372
5 TraesCS3A01G099900 chr5A 97.215 1149 12 7 797 1937 243926750 243927886 0.000000e+00 1927
6 TraesCS3A01G099900 chr1A 93.496 1968 70 20 1 1937 572013489 572011549 0.000000e+00 2872
7 TraesCS3A01G099900 chr1A 96.178 968 7 2 1 964 486952417 486951476 0.000000e+00 1555
8 TraesCS3A01G099900 chr7A 92.604 1974 79 22 1 1937 133613910 133611967 0.000000e+00 2774
9 TraesCS3A01G099900 chr7A 92.322 1667 54 34 845 2465 134462926 134464564 0.000000e+00 2302
10 TraesCS3A01G099900 chr7A 96.454 1128 30 4 811 1937 164738120 164737002 0.000000e+00 1853
11 TraesCS3A01G099900 chr7A 95.884 1142 29 7 804 1937 642166638 642167769 0.000000e+00 1832
12 TraesCS3A01G099900 chr2A 94.975 1632 53 8 845 2464 514764922 514766536 0.000000e+00 2532
13 TraesCS3A01G099900 chr2A 94.644 1587 35 28 797 2345 764068135 764069709 0.000000e+00 2414
14 TraesCS3A01G099900 chr2A 94.418 627 18 6 1 611 14783886 14784511 0.000000e+00 948
15 TraesCS3A01G099900 chr5B 95.880 1238 17 2 1262 2465 639228906 639230143 0.000000e+00 1973
16 TraesCS3A01G099900 chr3B 95.880 1238 17 2 1262 2465 472647891 472649128 0.000000e+00 1973
17 TraesCS3A01G099900 chr3B 95.638 1238 20 7 1262 2465 296181029 296179792 0.000000e+00 1956
18 TraesCS3A01G099900 chr3B 95.477 1238 22 2 1262 2465 764351819 764353056 0.000000e+00 1945
19 TraesCS3A01G099900 chr2B 95.153 1238 25 20 1262 2465 626098227 626096991 0.000000e+00 1921
20 TraesCS3A01G099900 chr2B 96.488 968 4 2 1 964 626099161 626098220 0.000000e+00 1572
21 TraesCS3A01G099900 chr7D 94.599 648 13 8 1 632 498405800 498406441 0.000000e+00 983
22 TraesCS3A01G099900 chr7D 96.907 194 6 0 628 821 530866537 530866344 2.360000e-85 326
23 TraesCS3A01G099900 chr7D 95.876 194 8 0 628 821 498406499 498406692 5.120000e-82 315
24 TraesCS3A01G099900 chr5D 94.969 636 17 5 1 632 351308893 351309517 0.000000e+00 983
25 TraesCS3A01G099900 chr5D 96.392 194 7 0 628 821 443522172 443522365 1.100000e-83 320
26 TraesCS3A01G099900 chr4D 94.444 648 14 6 1 632 440465234 440464593 0.000000e+00 977
27 TraesCS3A01G099900 chr4D 95.876 194 8 0 628 821 440464535 440464342 5.120000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G099900 chr3A 64314295 64316759 2464 True 4553.0 4553 100.0000 1 2465 1 chr3A.!!$R1 2464
1 TraesCS3A01G099900 chr3A 674546182 674547419 1237 True 1923.0 1923 95.1530 1262 2465 1 chr3A.!!$R2 1203
2 TraesCS3A01G099900 chr5A 602497645 602500120 2475 False 4030.0 4030 96.1630 1 2465 1 chr5A.!!$F4 2464
3 TraesCS3A01G099900 chr5A 513857969 513859663 1694 False 2630.0 2630 94.9590 797 2465 1 chr5A.!!$F2 1668
4 TraesCS3A01G099900 chr5A 562131924 562133542 1618 False 2372.0 2372 93.1790 845 2465 1 chr5A.!!$F3 1620
5 TraesCS3A01G099900 chr5A 243926750 243927886 1136 False 1927.0 1927 97.2150 797 1937 1 chr5A.!!$F1 1140
6 TraesCS3A01G099900 chr1A 572011549 572013489 1940 True 2872.0 2872 93.4960 1 1937 1 chr1A.!!$R2 1936
7 TraesCS3A01G099900 chr1A 486951476 486952417 941 True 1555.0 1555 96.1780 1 964 1 chr1A.!!$R1 963
8 TraesCS3A01G099900 chr7A 133611967 133613910 1943 True 2774.0 2774 92.6040 1 1937 1 chr7A.!!$R1 1936
9 TraesCS3A01G099900 chr7A 134462926 134464564 1638 False 2302.0 2302 92.3220 845 2465 1 chr7A.!!$F1 1620
10 TraesCS3A01G099900 chr7A 164737002 164738120 1118 True 1853.0 1853 96.4540 811 1937 1 chr7A.!!$R2 1126
11 TraesCS3A01G099900 chr7A 642166638 642167769 1131 False 1832.0 1832 95.8840 804 1937 1 chr7A.!!$F2 1133
12 TraesCS3A01G099900 chr2A 514764922 514766536 1614 False 2532.0 2532 94.9750 845 2464 1 chr2A.!!$F2 1619
13 TraesCS3A01G099900 chr2A 764068135 764069709 1574 False 2414.0 2414 94.6440 797 2345 1 chr2A.!!$F3 1548
14 TraesCS3A01G099900 chr2A 14783886 14784511 625 False 948.0 948 94.4180 1 611 1 chr2A.!!$F1 610
15 TraesCS3A01G099900 chr5B 639228906 639230143 1237 False 1973.0 1973 95.8800 1262 2465 1 chr5B.!!$F1 1203
16 TraesCS3A01G099900 chr3B 472647891 472649128 1237 False 1973.0 1973 95.8800 1262 2465 1 chr3B.!!$F1 1203
17 TraesCS3A01G099900 chr3B 296179792 296181029 1237 True 1956.0 1956 95.6380 1262 2465 1 chr3B.!!$R1 1203
18 TraesCS3A01G099900 chr3B 764351819 764353056 1237 False 1945.0 1945 95.4770 1262 2465 1 chr3B.!!$F2 1203
19 TraesCS3A01G099900 chr2B 626096991 626099161 2170 True 1746.5 1921 95.8205 1 2465 2 chr2B.!!$R1 2464
20 TraesCS3A01G099900 chr7D 498405800 498406692 892 False 649.0 983 95.2375 1 821 2 chr7D.!!$F1 820
21 TraesCS3A01G099900 chr5D 351308893 351309517 624 False 983.0 983 94.9690 1 632 1 chr5D.!!$F1 631
22 TraesCS3A01G099900 chr4D 440464342 440465234 892 True 646.0 977 95.1600 1 821 2 chr4D.!!$R1 820

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
559 615 1.08992 GGTGGAGATGTGTGATGTGC 58.91 55.0 0.0 0.0 0.0 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2113 2654 1.596934 GAAGATGTGGTGGAGCCGA 59.403 57.895 0.0 0.0 41.21 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 4.357947 GTCAGCCTGTCGCCGTCA 62.358 66.667 0.00 0.0 38.78 4.35
519 525 1.827789 GGGTTGTCCTGTGCAGCAA 60.828 57.895 0.00 0.0 0.00 3.91
559 615 1.089920 GGTGGAGATGTGTGATGTGC 58.910 55.000 0.00 0.0 0.00 4.57
667 785 5.552870 ACATGACTGAACCTTAGAACACT 57.447 39.130 0.00 0.0 0.00 3.55
989 1121 6.303839 AGATTCTACAAAGGTGCCTAACAAA 58.696 36.000 0.00 0.0 0.00 2.83
1146 1278 6.560253 TCCAAGCTTTTTGACTATCAAGAC 57.440 37.500 0.00 0.0 37.70 3.01
2050 2591 3.495100 GCACTTCACTCCTCCTTCTTCAA 60.495 47.826 0.00 0.0 0.00 2.69
2113 2654 2.358737 CTTCTTCTTGCCCGGCGT 60.359 61.111 6.01 0.0 0.00 5.68
2374 2927 0.448593 GAGGACTCGTCGTCTGAAGG 59.551 60.000 11.35 0.0 42.44 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
519 525 7.232534 TCCACCAGCAAAACAAGATTTAATACT 59.767 33.333 0.00 0.00 0.00 2.12
559 615 1.199327 CACACATCTCCAGCAGCAAAG 59.801 52.381 0.00 0.00 0.00 2.77
667 785 7.976175 CAGTACACTAAAGATCTCTGCATGTAA 59.024 37.037 0.00 0.00 0.00 2.41
1914 2369 8.303156 CAGCACTATCTACTTGCTATCTATGTT 58.697 37.037 0.00 0.00 44.87 2.71
1928 2383 4.982999 TCAGTTTCGTCAGCACTATCTAC 58.017 43.478 0.00 0.00 0.00 2.59
2050 2591 2.249413 CTCCCAGCGCCTGAAGATGT 62.249 60.000 2.29 0.00 32.44 3.06
2113 2654 1.596934 GAAGATGTGGTGGAGCCGA 59.403 57.895 0.00 0.00 41.21 5.54
2325 2878 2.170187 AGTCCAGTGAAGATGATGAGGC 59.830 50.000 0.00 0.00 0.00 4.70
2374 2927 4.104417 ACGACTCTGACGGCGAGC 62.104 66.667 16.62 5.63 34.93 5.03


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.