Multiple sequence alignment - TraesCS3A01G095500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G095500 chr3A 100.000 2321 0 0 1 2321 60827770 60825450 0.000000e+00 4287.0
1 TraesCS3A01G095500 chr3A 96.941 2288 68 2 34 2321 740090387 740088102 0.000000e+00 3836.0
2 TraesCS3A01G095500 chr2A 97.889 2321 49 0 1 2321 690342163 690344483 0.000000e+00 4015.0
3 TraesCS3A01G095500 chr7A 97.588 2322 52 2 1 2321 665977650 665979968 0.000000e+00 3975.0
4 TraesCS3A01G095500 chr7A 97.424 2290 57 1 34 2321 94445635 94443346 0.000000e+00 3901.0
5 TraesCS3A01G095500 chr5A 97.290 2288 61 1 34 2321 30143776 30146062 0.000000e+00 3880.0
6 TraesCS3A01G095500 chr2D 96.514 2295 72 2 34 2321 63681737 63684030 0.000000e+00 3788.0
7 TraesCS3A01G095500 chr7D 96.353 2276 75 2 53 2321 463977644 463979918 0.000000e+00 3736.0
8 TraesCS3A01G095500 chr4D 96.527 2217 69 2 112 2321 496006351 496008566 0.000000e+00 3661.0
9 TraesCS3A01G095500 chr4D 96.123 1625 61 2 34 1658 30903995 30905617 0.000000e+00 2651.0
10 TraesCS3A01G095500 chr4D 100.000 36 0 0 1 36 496006268 496006303 1.490000e-07 67.6
11 TraesCS3A01G095500 chr6D 95.154 2332 90 4 1 2311 80673036 80670707 0.000000e+00 3659.0
12 TraesCS3A01G095500 chr5D 95.011 2345 90 7 1 2321 60521646 60519305 0.000000e+00 3657.0
13 TraesCS3A01G095500 chr1A 95.457 2289 98 4 34 2321 72584857 72587140 0.000000e+00 3646.0
14 TraesCS3A01G095500 chr1B 94.151 2325 110 10 1 2302 122762301 122764622 0.000000e+00 3517.0
15 TraesCS3A01G095500 chr4B 93.470 2343 115 20 1 2320 82274868 82272541 0.000000e+00 3445.0
16 TraesCS3A01G095500 chr4B 92.865 855 44 4 1 840 109235801 109234949 0.000000e+00 1225.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G095500 chr3A 60825450 60827770 2320 True 4287.0 4287 100.0000 1 2321 1 chr3A.!!$R1 2320
1 TraesCS3A01G095500 chr3A 740088102 740090387 2285 True 3836.0 3836 96.9410 34 2321 1 chr3A.!!$R2 2287
2 TraesCS3A01G095500 chr2A 690342163 690344483 2320 False 4015.0 4015 97.8890 1 2321 1 chr2A.!!$F1 2320
3 TraesCS3A01G095500 chr7A 665977650 665979968 2318 False 3975.0 3975 97.5880 1 2321 1 chr7A.!!$F1 2320
4 TraesCS3A01G095500 chr7A 94443346 94445635 2289 True 3901.0 3901 97.4240 34 2321 1 chr7A.!!$R1 2287
5 TraesCS3A01G095500 chr5A 30143776 30146062 2286 False 3880.0 3880 97.2900 34 2321 1 chr5A.!!$F1 2287
6 TraesCS3A01G095500 chr2D 63681737 63684030 2293 False 3788.0 3788 96.5140 34 2321 1 chr2D.!!$F1 2287
7 TraesCS3A01G095500 chr7D 463977644 463979918 2274 False 3736.0 3736 96.3530 53 2321 1 chr7D.!!$F1 2268
8 TraesCS3A01G095500 chr4D 30903995 30905617 1622 False 2651.0 2651 96.1230 34 1658 1 chr4D.!!$F1 1624
9 TraesCS3A01G095500 chr4D 496006268 496008566 2298 False 1864.3 3661 98.2635 1 2321 2 chr4D.!!$F2 2320
10 TraesCS3A01G095500 chr6D 80670707 80673036 2329 True 3659.0 3659 95.1540 1 2311 1 chr6D.!!$R1 2310
11 TraesCS3A01G095500 chr5D 60519305 60521646 2341 True 3657.0 3657 95.0110 1 2321 1 chr5D.!!$R1 2320
12 TraesCS3A01G095500 chr1A 72584857 72587140 2283 False 3646.0 3646 95.4570 34 2321 1 chr1A.!!$F1 2287
13 TraesCS3A01G095500 chr1B 122762301 122764622 2321 False 3517.0 3517 94.1510 1 2302 1 chr1B.!!$F1 2301
14 TraesCS3A01G095500 chr4B 82272541 82274868 2327 True 3445.0 3445 93.4700 1 2320 1 chr4B.!!$R1 2319
15 TraesCS3A01G095500 chr4B 109234949 109235801 852 True 1225.0 1225 92.8650 1 840 1 chr4B.!!$R2 839

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
880 910 0.401395 AAGTGGAGTTGGGGGTCAGA 60.401 55.0 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2269 2322 2.288702 CGAAGATGGATGAGCGGAAGAT 60.289 50.0 0.0 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 163 7.942341 TGACCTTATTTTGTAGGATGTTTGAGT 59.058 33.333 0.00 0.0 35.45 3.41
352 381 3.778955 ACGTGAGTCCTGGAGGTG 58.221 61.111 0.00 0.0 44.19 4.00
652 682 1.526917 CTCCCCCGTGGATTCATGC 60.527 63.158 0.00 0.0 44.07 4.06
880 910 0.401395 AAGTGGAGTTGGGGGTCAGA 60.401 55.000 0.00 0.0 0.00 3.27
905 935 2.895404 ACTAGCCTTCTTGTACCGTCAA 59.105 45.455 0.00 0.0 0.00 3.18
1485 1521 5.240623 TCGAAGCAATTTGGAGTACAACAAT 59.759 36.000 0.00 0.0 39.19 2.71
1706 1744 1.757118 CTCAGAGGAATGCCCGAGTTA 59.243 52.381 0.00 0.0 40.87 2.24
2110 2148 5.782845 AGGTTAGAGGCCCTCTTAATATGAG 59.217 44.000 20.49 0.0 41.50 2.90
2218 2271 2.228822 CGCTTTACTTTCTTGCCATGGT 59.771 45.455 14.67 0.0 0.00 3.55
2269 2322 5.539955 TGCTCAGTATAGAATGGATGTGCTA 59.460 40.000 0.00 0.0 0.00 3.49
2296 2349 1.873069 GCTCATCCATCTTCGAGCCAG 60.873 57.143 0.00 0.0 44.06 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
346 375 2.338015 TAGCGACGGTCACACCTCC 61.338 63.158 1.23 0.00 35.66 4.30
652 682 3.282885 GGCCTAGGATCCTTCTTTGTTG 58.717 50.000 22.03 1.17 0.00 3.33
1388 1423 0.030638 GCACACGCCAAAGATGTTGT 59.969 50.000 0.00 0.00 0.00 3.32
1706 1744 4.356405 TGTCAGGTGTGTGATCATCTTT 57.644 40.909 0.00 0.00 0.00 2.52
2110 2148 6.400303 GCAAAAATAGTTCACATGACACATGC 60.400 38.462 0.00 0.00 0.00 4.06
2269 2322 2.288702 CGAAGATGGATGAGCGGAAGAT 60.289 50.000 0.00 0.00 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.