Multiple sequence alignment - TraesCS3A01G092500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G092500 chr3A 100.000 2398 0 0 1 2398 58078400 58076003 0.000000e+00 4429
1 TraesCS3A01G092500 chr3A 97.227 2416 46 9 1 2398 171150131 171152543 0.000000e+00 4071
2 TraesCS3A01G092500 chr3A 96.565 2416 62 10 1 2398 545676421 545674009 0.000000e+00 3982
3 TraesCS3A01G092500 chr3A 96.487 1822 43 9 594 2398 122115255 122117072 0.000000e+00 2990
4 TraesCS3A01G092500 chr3A 96.107 1824 52 8 594 2398 48905594 48907417 0.000000e+00 2957
5 TraesCS3A01G092500 chr1A 97.101 2415 53 6 1 2398 181970719 181968305 0.000000e+00 4056
6 TraesCS3A01G092500 chr1A 97.104 2417 48 10 1 2398 359190690 359193103 0.000000e+00 4056
7 TraesCS3A01G092500 chr1A 96.235 2417 53 14 1 2398 579041649 579039252 0.000000e+00 3925
8 TraesCS3A01G092500 chr1A 96.391 2355 50 12 62 2398 67962183 67959846 0.000000e+00 3845
9 TraesCS3A01G092500 chr7A 95.996 1823 52 9 594 2398 723589399 723591218 0.000000e+00 2942
10 TraesCS3A01G092500 chr7A 97.009 535 16 0 62 596 662680420 662680954 0.000000e+00 900
11 TraesCS3A01G092500 chr7A 100.000 64 0 0 1 64 662679753 662679816 4.190000e-23 119
12 TraesCS3A01G092500 chr2B 95.691 557 5 6 1858 2397 295698841 295699395 0.000000e+00 878
13 TraesCS3A01G092500 chr2B 94.991 559 7 4 1859 2398 318591962 318591406 0.000000e+00 857
14 TraesCS3A01G092500 chr2B 94.812 559 8 4 1858 2398 659266658 659267213 0.000000e+00 852
15 TraesCS3A01G092500 chr3B 94.812 559 9 3 1858 2398 173328978 173328422 0.000000e+00 854
16 TraesCS3A01G092500 chr1B 94.812 559 8 3 1858 2398 501625789 501625234 0.000000e+00 852
17 TraesCS3A01G092500 chr4D 95.783 498 17 2 62 559 99934868 99935361 0.000000e+00 800
18 TraesCS3A01G092500 chr4D 95.783 498 17 2 62 559 446550868 446550375 0.000000e+00 800
19 TraesCS3A01G092500 chr4D 100.000 64 0 0 1 64 99934204 99934267 4.190000e-23 119
20 TraesCS3A01G092500 chr4D 98.438 64 1 0 1 64 446551531 446551468 1.950000e-21 113
21 TraesCS3A01G092500 chr7B 100.000 64 0 0 1 64 574900460 574900397 4.190000e-23 119


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G092500 chr3A 58076003 58078400 2397 True 4429.0 4429 100.0000 1 2398 1 chr3A.!!$R1 2397
1 TraesCS3A01G092500 chr3A 171150131 171152543 2412 False 4071.0 4071 97.2270 1 2398 1 chr3A.!!$F3 2397
2 TraesCS3A01G092500 chr3A 545674009 545676421 2412 True 3982.0 3982 96.5650 1 2398 1 chr3A.!!$R2 2397
3 TraesCS3A01G092500 chr3A 122115255 122117072 1817 False 2990.0 2990 96.4870 594 2398 1 chr3A.!!$F2 1804
4 TraesCS3A01G092500 chr3A 48905594 48907417 1823 False 2957.0 2957 96.1070 594 2398 1 chr3A.!!$F1 1804
5 TraesCS3A01G092500 chr1A 181968305 181970719 2414 True 4056.0 4056 97.1010 1 2398 1 chr1A.!!$R2 2397
6 TraesCS3A01G092500 chr1A 359190690 359193103 2413 False 4056.0 4056 97.1040 1 2398 1 chr1A.!!$F1 2397
7 TraesCS3A01G092500 chr1A 579039252 579041649 2397 True 3925.0 3925 96.2350 1 2398 1 chr1A.!!$R3 2397
8 TraesCS3A01G092500 chr1A 67959846 67962183 2337 True 3845.0 3845 96.3910 62 2398 1 chr1A.!!$R1 2336
9 TraesCS3A01G092500 chr7A 723589399 723591218 1819 False 2942.0 2942 95.9960 594 2398 1 chr7A.!!$F1 1804
10 TraesCS3A01G092500 chr7A 662679753 662680954 1201 False 509.5 900 98.5045 1 596 2 chr7A.!!$F2 595
11 TraesCS3A01G092500 chr2B 295698841 295699395 554 False 878.0 878 95.6910 1858 2397 1 chr2B.!!$F1 539
12 TraesCS3A01G092500 chr2B 318591406 318591962 556 True 857.0 857 94.9910 1859 2398 1 chr2B.!!$R1 539
13 TraesCS3A01G092500 chr2B 659266658 659267213 555 False 852.0 852 94.8120 1858 2398 1 chr2B.!!$F2 540
14 TraesCS3A01G092500 chr3B 173328422 173328978 556 True 854.0 854 94.8120 1858 2398 1 chr3B.!!$R1 540
15 TraesCS3A01G092500 chr1B 501625234 501625789 555 True 852.0 852 94.8120 1858 2398 1 chr1B.!!$R1 540
16 TraesCS3A01G092500 chr4D 99934204 99935361 1157 False 459.5 800 97.8915 1 559 2 chr4D.!!$F1 558
17 TraesCS3A01G092500 chr4D 446550375 446551531 1156 True 456.5 800 97.1105 1 559 2 chr4D.!!$R1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
642 1249 0.177141 GACAGGTGTTATGGCGGCTA 59.823 55.0 11.43 0.0 0.0 3.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2351 2983 1.131638 CTAGCTACATGGGCTTGGGA 58.868 55.0 18.02 2.79 40.74 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
297 904 1.133025 GATGCAAATTGTAGGCACGCT 59.867 47.619 0.00 0.00 40.83 5.07
444 1051 5.350365 TGTTGCAGAAAGTTATAGGTAAGCG 59.650 40.000 0.00 0.00 0.00 4.68
626 1233 2.288825 GGACAAGATCAACGAGGTGACA 60.289 50.000 0.00 0.00 0.00 3.58
642 1249 0.177141 GACAGGTGTTATGGCGGCTA 59.823 55.000 11.43 0.00 0.00 3.93
890 1497 8.122472 TCATCAGATAGTTAACTCACTGTGAA 57.878 34.615 26.46 16.34 33.87 3.18
903 1510 5.070446 ACTCACTGTGAAATGTCCACTCTTA 59.930 40.000 12.16 0.00 35.66 2.10
1091 1698 1.442769 GTCACCATGAAGCGATGTGT 58.557 50.000 0.00 0.00 0.00 3.72
1093 1700 0.448990 CACCATGAAGCGATGTGTGG 59.551 55.000 0.00 0.00 0.00 4.17
1124 1731 1.540363 CCTTACAGCTGGTTCGTGTGT 60.540 52.381 19.93 0.00 0.00 3.72
1340 1947 2.017049 GCTGGTTCGGCATTATGTCTT 58.983 47.619 0.00 0.00 35.55 3.01
1463 2073 5.926542 GCATATTTCCTTCGTGTATCTGCTA 59.073 40.000 0.00 0.00 0.00 3.49
1754 2365 5.221541 GGAGGAGTACATGCTTGTAATAGCT 60.222 44.000 13.52 7.09 39.96 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 700 7.554835 ACAACAACAATACCAACTAACAAGAGA 59.445 33.333 0.00 0.00 0.00 3.10
297 904 2.271173 CATCTGCCAGCAGCCTCA 59.729 61.111 14.86 0.00 43.31 3.86
310 917 0.700564 TTGCCCCTGAAGAAGCATCT 59.299 50.000 0.00 0.00 37.57 2.90
444 1051 1.519719 TGGCACAAACAAGTTGGCC 59.480 52.632 7.96 10.22 46.08 5.36
598 1205 4.560128 CTCGTTGATCTTGTCCTTGAAGA 58.440 43.478 0.00 0.00 34.00 2.87
626 1233 0.837272 ACATAGCCGCCATAACACCT 59.163 50.000 0.00 0.00 0.00 4.00
642 1249 1.536907 TGGGGTCACCACCGTACAT 60.537 57.895 0.00 0.00 46.80 2.29
903 1510 9.412460 TCCTGCTATCTGATGAATTAACAAAAT 57.588 29.630 0.00 0.00 0.00 1.82
1093 1700 1.343431 GCTGTAAGGGTAGGGGGTCC 61.343 65.000 0.00 0.00 0.00 4.46
1124 1731 4.085733 CCCATCAAATCTACAACCCACAA 58.914 43.478 0.00 0.00 0.00 3.33
1340 1947 5.774690 AGAATTAAGGCAAAACACATCCAGA 59.225 36.000 0.00 0.00 0.00 3.86
1434 2044 8.131100 CAGATACACGAAGGAAATATGCAAATT 58.869 33.333 0.00 0.00 0.00 1.82
1463 2073 7.651808 CAAACTGGAGTTGTTTCAGTTCATAT 58.348 34.615 8.15 0.00 46.92 1.78
1616 2226 5.712152 AAAGACCATGAAACAGACATTCC 57.288 39.130 0.00 0.00 0.00 3.01
1971 2583 4.637276 TCACAGCTTCGAACTTGGATTTA 58.363 39.130 0.00 0.00 0.00 1.40
2351 2983 1.131638 CTAGCTACATGGGCTTGGGA 58.868 55.000 18.02 2.79 40.74 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.