Multiple sequence alignment - TraesCS3A01G089800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G089800 chr3A 100.000 3545 0 0 1 3545 57270231 57273775 0.000000e+00 6547
1 TraesCS3A01G089800 chr3A 97.211 1219 12 2 2 1220 23452221 23451025 0.000000e+00 2043
2 TraesCS3A01G089800 chr3A 98.707 232 3 0 1 232 23447138 23447369 2.550000e-111 412
3 TraesCS3A01G089800 chr3A 97.414 232 6 0 1 232 57277726 57277495 2.560000e-106 396
4 TraesCS3A01G089800 chr5B 99.352 3551 17 2 1 3545 339089008 339085458 0.000000e+00 6425
5 TraesCS3A01G089800 chr1A 98.759 3545 43 1 1 3545 582535638 582539181 0.000000e+00 6301
6 TraesCS3A01G089800 chr1A 98.617 3544 27 4 2 3545 500066787 500070308 0.000000e+00 6253
7 TraesCS3A01G089800 chr7B 98.590 3547 26 3 1 3545 122631862 122628338 0.000000e+00 6252
8 TraesCS3A01G089800 chr7A 98.402 3566 35 3 1 3545 652475043 652478607 0.000000e+00 6250
9 TraesCS3A01G089800 chr7A 98.172 3556 52 5 2 3545 299422967 299419413 0.000000e+00 6194
10 TraesCS3A01G089800 chr4B 98.590 3545 28 2 1 3545 451444084 451447606 0.000000e+00 6250
11 TraesCS3A01G089800 chr3B 98.392 3545 35 2 1 3545 344139998 344143520 0.000000e+00 6211
12 TraesCS3A01G089800 chr6B 98.033 3558 56 5 1 3545 225321825 225318269 0.000000e+00 6170
13 TraesCS3A01G089800 chr2A 97.943 3549 47 3 1 3545 72960917 72957391 0.000000e+00 6126
14 TraesCS3A01G089800 chr2A 92.667 300 18 4 1 297 507377848 507378146 2.530000e-116 429
15 TraesCS3A01G089800 chr5A 97.892 2419 29 2 1 2419 69226396 69228792 0.000000e+00 4165


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G089800 chr3A 57270231 57273775 3544 False 6547 6547 100.000 1 3545 1 chr3A.!!$F2 3544
1 TraesCS3A01G089800 chr3A 23451025 23452221 1196 True 2043 2043 97.211 2 1220 1 chr3A.!!$R1 1218
2 TraesCS3A01G089800 chr5B 339085458 339089008 3550 True 6425 6425 99.352 1 3545 1 chr5B.!!$R1 3544
3 TraesCS3A01G089800 chr1A 582535638 582539181 3543 False 6301 6301 98.759 1 3545 1 chr1A.!!$F2 3544
4 TraesCS3A01G089800 chr1A 500066787 500070308 3521 False 6253 6253 98.617 2 3545 1 chr1A.!!$F1 3543
5 TraesCS3A01G089800 chr7B 122628338 122631862 3524 True 6252 6252 98.590 1 3545 1 chr7B.!!$R1 3544
6 TraesCS3A01G089800 chr7A 652475043 652478607 3564 False 6250 6250 98.402 1 3545 1 chr7A.!!$F1 3544
7 TraesCS3A01G089800 chr7A 299419413 299422967 3554 True 6194 6194 98.172 2 3545 1 chr7A.!!$R1 3543
8 TraesCS3A01G089800 chr4B 451444084 451447606 3522 False 6250 6250 98.590 1 3545 1 chr4B.!!$F1 3544
9 TraesCS3A01G089800 chr3B 344139998 344143520 3522 False 6211 6211 98.392 1 3545 1 chr3B.!!$F1 3544
10 TraesCS3A01G089800 chr6B 225318269 225321825 3556 True 6170 6170 98.033 1 3545 1 chr6B.!!$R1 3544
11 TraesCS3A01G089800 chr2A 72957391 72960917 3526 True 6126 6126 97.943 1 3545 1 chr2A.!!$R1 3544
12 TraesCS3A01G089800 chr5A 69226396 69228792 2396 False 4165 4165 97.892 1 2419 1 chr5A.!!$F1 2418

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
148 159 2.185238 GTGCTGACTAGGACGAGCT 58.815 57.895 0.0 0.0 35.5 4.09 F
1411 1489 6.491714 TGGAAGAAGAAGAAGAGGGATATG 57.508 41.667 0.0 0.0 0.0 1.78 F
1959 2037 7.888021 TGTATGAAGTTGTGTTTTAGGGATCAT 59.112 33.333 0.0 0.0 0.0 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1411 1489 4.819088 GTCCTCATAAGCCTCAAATCCTTC 59.181 45.833 0.0 0.0 0.0 3.46 R
2398 2476 6.578313 AGTGACTATTACTCTACTCCCAGA 57.422 41.667 0.0 0.0 0.0 3.86 R
3488 3580 2.106338 TCCTGCATCCACAAGTCTCAAA 59.894 45.455 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 159 2.185238 GTGCTGACTAGGACGAGCT 58.815 57.895 0.00 0.0 35.50 4.09
1411 1489 6.491714 TGGAAGAAGAAGAAGAGGGATATG 57.508 41.667 0.00 0.0 0.00 1.78
1959 2037 7.888021 TGTATGAAGTTGTGTTTTAGGGATCAT 59.112 33.333 0.00 0.0 0.00 2.45
2398 2476 3.134623 TCAGACTGTCATGGACACAAACT 59.865 43.478 10.88 0.0 37.67 2.66
2800 2878 1.003573 CTAGGGGGAGAAGTGGGCT 59.996 63.158 0.00 0.0 0.00 5.19
3488 3580 2.165167 CACATGCTGTCAACCTGGAAT 58.835 47.619 0.00 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 159 2.878089 TTAGGACAGCAGCGCACCA 61.878 57.895 11.47 0.0 0.00 4.17
482 556 0.682209 CATGGCTGCTGCTAGGGTTT 60.682 55.000 15.64 0.0 39.59 3.27
1411 1489 4.819088 GTCCTCATAAGCCTCAAATCCTTC 59.181 45.833 0.00 0.0 0.00 3.46
1959 2037 6.487668 TCAACAAAGCTTCTCTGAATTGATGA 59.512 34.615 0.00 0.0 30.47 2.92
2398 2476 6.578313 AGTGACTATTACTCTACTCCCAGA 57.422 41.667 0.00 0.0 0.00 3.86
3488 3580 2.106338 TCCTGCATCCACAAGTCTCAAA 59.894 45.455 0.00 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.