Multiple sequence alignment - TraesCS3A01G081500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G081500 chr3A 100.000 4266 0 0 2359 6624 52590579 52594844 0.000000e+00 7878
1 TraesCS3A01G081500 chr3A 99.229 4022 31 0 2359 6380 52728865 52732886 0.000000e+00 7256
2 TraesCS3A01G081500 chr3A 99.180 4022 31 2 2359 6380 52823037 52827056 0.000000e+00 7243
3 TraesCS3A01G081500 chr3A 99.056 4024 36 1 2359 6380 52775166 52779189 0.000000e+00 7219
4 TraesCS3A01G081500 chr3A 98.906 4022 24 3 2359 6380 52637133 52641134 0.000000e+00 7166
5 TraesCS3A01G081500 chr3A 99.289 3656 26 0 2725 6380 52683099 52686754 0.000000e+00 6608
6 TraesCS3A01G081500 chr3A 100.000 2018 0 0 1 2018 52588221 52590238 0.000000e+00 3727
7 TraesCS3A01G081500 chr3A 99.406 2019 10 2 1 2018 52772710 52774727 0.000000e+00 3661
8 TraesCS3A01G081500 chr3A 99.406 2019 8 2 1 2018 52726412 52728427 0.000000e+00 3659
9 TraesCS3A01G081500 chr3A 99.205 2013 15 1 1 2012 52820601 52822613 0.000000e+00 3627
10 TraesCS3A01G081500 chr3A 99.518 1452 7 0 567 2018 52681121 52682572 0.000000e+00 2643
11 TraesCS3A01G081500 chr3A 99.494 1383 6 1 1 1382 52634563 52635945 0.000000e+00 2514
12 TraesCS3A01G081500 chr3A 99.811 530 0 1 1 529 52680581 52681110 0.000000e+00 972
13 TraesCS3A01G081500 chr3A 99.600 250 1 0 6375 6624 52641173 52641422 2.180000e-124 457
14 TraesCS3A01G081500 chr3A 99.600 250 1 0 6375 6624 52779228 52779477 2.180000e-124 457
15 TraesCS3A01G081500 chr3A 99.200 250 2 0 6375 6624 52686793 52687042 1.010000e-122 451
16 TraesCS3A01G081500 chr3A 99.200 250 2 0 6375 6624 52732925 52733174 1.010000e-122 451
17 TraesCS3A01G081500 chr3A 99.203 251 1 1 6375 6624 52827095 52827345 1.010000e-122 451
18 TraesCS3A01G081500 chr3D 91.744 2592 187 18 2360 4939 41037445 41040021 0.000000e+00 3576
19 TraesCS3A01G081500 chr3D 90.676 2574 227 12 2360 4923 40913006 40915576 0.000000e+00 3411
20 TraesCS3A01G081500 chr3D 93.303 1986 117 9 1 1977 41035044 41037022 0.000000e+00 2916
21 TraesCS3A01G081500 chr3D 91.617 1515 110 11 4 1512 40910588 40912091 0.000000e+00 2078
22 TraesCS3A01G081500 chr3D 95.994 724 23 3 4918 5640 41040031 41040749 0.000000e+00 1171
23 TraesCS3A01G081500 chr3D 94.061 724 39 2 4918 5640 40915602 40916322 0.000000e+00 1096
24 TraesCS3A01G081500 chr3D 87.031 586 50 10 5802 6380 41040748 41041314 7.240000e-179 638
25 TraesCS3A01G081500 chr3D 92.449 437 31 1 1558 1994 40912090 40912524 2.030000e-174 623
26 TraesCS3A01G081500 chr3D 81.210 463 28 28 5802 6255 40916321 40916733 1.070000e-82 318
27 TraesCS3A01G081500 chrUn 99.556 1126 3 2 1 1125 423824721 423823597 0.000000e+00 2050
28 TraesCS3A01G081500 chr2D 79.381 388 77 1 1519 1906 2891466 2891850 3.040000e-68 270
29 TraesCS3A01G081500 chr2B 79.434 389 75 3 1519 1906 8237360 8236976 3.040000e-68 270
30 TraesCS3A01G081500 chr2B 79.177 389 76 3 1519 1906 8081894 8081510 1.420000e-66 265
31 TraesCS3A01G081500 chr2B 80.952 273 50 2 5346 5617 7909049 7908778 1.450000e-51 215
32 TraesCS3A01G081500 chr2B 80.586 273 51 2 5346 5617 8078783 8078512 6.730000e-50 209
33 TraesCS3A01G081500 chr2B 77.465 284 56 4 1038 1317 7912866 7912587 5.310000e-36 163
34 TraesCS3A01G081500 chr2B 76.408 284 59 4 1038 1317 7803519 7803240 5.350000e-31 147
35 TraesCS3A01G081500 chr1D 92.179 179 14 0 5637 5815 206955703 206955525 3.070000e-63 254
36 TraesCS3A01G081500 chr6A 93.023 172 12 0 5634 5805 276304330 276304159 1.100000e-62 252
37 TraesCS3A01G081500 chr2A 91.304 184 13 3 5635 5817 94112553 94112372 1.430000e-61 248
38 TraesCS3A01G081500 chr1A 87.864 206 21 3 5638 5841 233421341 233421544 8.580000e-59 239


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G081500 chr3A 52588221 52594844 6623 False 5802.500000 7878 100.000000 1 6624 2 chr3A.!!$F1 6623
1 TraesCS3A01G081500 chr3A 52726412 52733174 6762 False 3788.666667 7256 99.278333 1 6624 3 chr3A.!!$F4 6623
2 TraesCS3A01G081500 chr3A 52772710 52779477 6767 False 3779.000000 7219 99.354000 1 6624 3 chr3A.!!$F5 6623
3 TraesCS3A01G081500 chr3A 52820601 52827345 6744 False 3773.666667 7243 99.196000 1 6624 3 chr3A.!!$F6 6623
4 TraesCS3A01G081500 chr3A 52634563 52641422 6859 False 3379.000000 7166 99.333333 1 6624 3 chr3A.!!$F2 6623
5 TraesCS3A01G081500 chr3A 52680581 52687042 6461 False 2668.500000 6608 99.454500 1 6624 4 chr3A.!!$F3 6623
6 TraesCS3A01G081500 chr3D 41035044 41041314 6270 False 2075.250000 3576 92.018000 1 6380 4 chr3D.!!$F2 6379
7 TraesCS3A01G081500 chr3D 40910588 40916733 6145 False 1505.200000 3411 90.002600 4 6255 5 chr3D.!!$F1 6251
8 TraesCS3A01G081500 chrUn 423823597 423824721 1124 True 2050.000000 2050 99.556000 1 1125 1 chrUn.!!$R1 1124
9 TraesCS3A01G081500 chr2B 8078512 8081894 3382 True 237.000000 265 79.881500 1519 5617 2 chr2B.!!$R4 4098

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
951 964 4.244862 CATTTATGCAGTTTTGGTGGGAC 58.755 43.478 0.0 0.0 0.00 4.46 F
1550 1565 5.659440 TCAATAAATTCAAGGCCCAAGAC 57.341 39.130 0.0 0.0 0.00 3.01 F
3023 3451 4.816385 CGGAAGTTACATGAAGCCATACAT 59.184 41.667 0.0 0.0 0.00 2.29 F
4322 4768 5.975693 GATCCCATCGATCTCTAGTTCTT 57.024 43.478 0.0 0.0 43.65 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3023 3451 2.038863 AATGTCCACCACTCCACCTA 57.961 50.000 0.0 0.0 0.00 3.08 R
4322 4768 0.179048 CTAGATCGCCAACCATGCCA 60.179 55.000 0.0 0.0 0.00 4.92 R
4990 6313 6.086765 GCTGACGTGATTTTGAAACTGTATTG 59.913 38.462 0.0 0.0 0.00 1.90 R
6165 7801 4.019051 TCATCACCAAATCTCACATGGACT 60.019 41.667 0.0 0.0 37.66 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
653 664 6.001460 TCACCTTTGTTAAGAATCAATCGGT 58.999 36.000 0.00 0.00 32.92 4.69
951 964 4.244862 CATTTATGCAGTTTTGGTGGGAC 58.755 43.478 0.00 0.00 0.00 4.46
1440 1455 7.408756 TGATTTTCTTAGTATGCATGCCTTT 57.591 32.000 16.68 2.45 0.00 3.11
1550 1565 5.659440 TCAATAAATTCAAGGCCCAAGAC 57.341 39.130 0.00 0.00 0.00 3.01
3023 3451 4.816385 CGGAAGTTACATGAAGCCATACAT 59.184 41.667 0.00 0.00 0.00 2.29
4322 4768 5.975693 GATCCCATCGATCTCTAGTTCTT 57.024 43.478 0.00 0.00 43.65 2.52
4990 6313 2.973694 ATCTTTTGCATGCACCCATC 57.026 45.000 22.58 0.00 0.00 3.51
5700 7326 7.956420 TTCAACAAATGACTACATACGAAGT 57.044 32.000 0.00 0.00 41.11 3.01
6165 7801 9.016438 GTGAGACCTGGGTAAATTTAATGTAAA 57.984 33.333 0.00 0.00 0.00 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1550 1565 1.221021 GTCCTTACTGAAGCCCCCG 59.779 63.158 0.0 0.0 0.00 5.73
3023 3451 2.038863 AATGTCCACCACTCCACCTA 57.961 50.000 0.0 0.0 0.00 3.08
4322 4768 0.179048 CTAGATCGCCAACCATGCCA 60.179 55.000 0.0 0.0 0.00 4.92
4990 6313 6.086765 GCTGACGTGATTTTGAAACTGTATTG 59.913 38.462 0.0 0.0 0.00 1.90
6165 7801 4.019051 TCATCACCAAATCTCACATGGACT 60.019 41.667 0.0 0.0 37.66 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.