Multiple sequence alignment - TraesCS3A01G080200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G080200 chr3A 100.000 2360 0 0 1 2360 51869813 51872172 0.000000e+00 4359
1 TraesCS3A01G080200 chr3A 98.008 2360 45 1 1 2360 633113889 633116246 0.000000e+00 4096
2 TraesCS3A01G080200 chr3A 92.373 354 13 4 1356 1707 673484677 673485018 2.110000e-135 492
3 TraesCS3A01G080200 chr3A 95.000 160 8 0 1076 1235 660604708 660604549 3.890000e-63 252
4 TraesCS3A01G080200 chr3A 95.050 101 5 0 779 879 17291747 17291647 2.430000e-35 159
5 TraesCS3A01G080200 chr7D 98.347 2360 38 1 1 2360 203518117 203520475 0.000000e+00 4141
6 TraesCS3A01G080200 chr7B 98.263 2360 41 0 1 2360 644470082 644472441 0.000000e+00 4132
7 TraesCS3A01G080200 chr7A 98.136 2360 44 0 1 2360 60120927 60118568 0.000000e+00 4115
8 TraesCS3A01G080200 chr7A 97.797 2360 51 1 1 2360 63429290 63431648 0.000000e+00 4069
9 TraesCS3A01G080200 chr7A 97.458 2360 58 1 1 2360 211272569 211270212 0.000000e+00 4024
10 TraesCS3A01G080200 chr6B 97.754 2360 51 2 1 2360 306993349 306990992 0.000000e+00 4063
11 TraesCS3A01G080200 chr2B 97.203 2360 59 3 1 2360 391110201 391107849 0.000000e+00 3986
12 TraesCS3A01G080200 chr2A 95.262 781 25 3 1580 2360 40346139 40346907 0.000000e+00 1227
13 TraesCS3A01G080200 chr2A 96.793 686 21 1 1 685 332941662 332940977 0.000000e+00 1144
14 TraesCS3A01G080200 chr2A 100.000 65 0 0 878 942 24353935 24353999 1.150000e-23 121


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G080200 chr3A 51869813 51872172 2359 False 4359 4359 100.000 1 2360 1 chr3A.!!$F1 2359
1 TraesCS3A01G080200 chr3A 633113889 633116246 2357 False 4096 4096 98.008 1 2360 1 chr3A.!!$F2 2359
2 TraesCS3A01G080200 chr7D 203518117 203520475 2358 False 4141 4141 98.347 1 2360 1 chr7D.!!$F1 2359
3 TraesCS3A01G080200 chr7B 644470082 644472441 2359 False 4132 4132 98.263 1 2360 1 chr7B.!!$F1 2359
4 TraesCS3A01G080200 chr7A 60118568 60120927 2359 True 4115 4115 98.136 1 2360 1 chr7A.!!$R1 2359
5 TraesCS3A01G080200 chr7A 63429290 63431648 2358 False 4069 4069 97.797 1 2360 1 chr7A.!!$F1 2359
6 TraesCS3A01G080200 chr7A 211270212 211272569 2357 True 4024 4024 97.458 1 2360 1 chr7A.!!$R2 2359
7 TraesCS3A01G080200 chr6B 306990992 306993349 2357 True 4063 4063 97.754 1 2360 1 chr6B.!!$R1 2359
8 TraesCS3A01G080200 chr2B 391107849 391110201 2352 True 3986 3986 97.203 1 2360 1 chr2B.!!$R1 2359
9 TraesCS3A01G080200 chr2A 40346139 40346907 768 False 1227 1227 95.262 1580 2360 1 chr2A.!!$F2 780
10 TraesCS3A01G080200 chr2A 332940977 332941662 685 True 1144 1144 96.793 1 685 1 chr2A.!!$R1 684

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
216 218 0.257039 CAGGAGGTTGGCTGCCTATT 59.743 55.0 21.03 5.03 36.29 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2038 2044 0.168128 GCAGCGAATAAAACGGCTGT 59.832 50.0 12.73 0.0 37.29 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 144 2.731571 GCACCTATCAGGCCCGACA 61.732 63.158 0.00 0.00 39.63 4.35
216 218 0.257039 CAGGAGGTTGGCTGCCTATT 59.743 55.000 21.03 5.03 36.29 1.73
310 312 6.860790 TTCTATATATATGGGTCCGTGCAA 57.139 37.500 5.44 0.00 0.00 4.08
326 328 4.614555 GTGCAACATTTCCACGATATCA 57.385 40.909 3.12 0.00 36.32 2.15
384 386 4.145052 TCTTGCCTCTATCATTAGCTCGA 58.855 43.478 0.00 0.00 0.00 4.04
503 505 0.394488 TGCCCCTTGTTCGTTTGTCA 60.394 50.000 0.00 0.00 0.00 3.58
625 627 3.846405 AACACCCTCTCCTCCGGCA 62.846 63.158 0.00 0.00 0.00 5.69
685 687 4.374399 AGGTCGTGTACAACAACCTTAAG 58.626 43.478 15.79 0.00 36.25 1.85
686 688 4.122046 GGTCGTGTACAACAACCTTAAGT 58.878 43.478 12.92 0.00 28.77 2.24
699 701 1.545428 CCTTAAGTGCACAAGCCTGGA 60.545 52.381 21.04 0.00 41.13 3.86
1062 1064 1.494721 ACCCTGCAACTGAGGAAAAGA 59.505 47.619 0.00 0.00 31.48 2.52
1095 1097 0.961019 AGGGAAGCGTGTACGTTGTA 59.039 50.000 6.27 0.00 42.22 2.41
1103 1105 2.859806 GCGTGTACGTTGTAACACTCCT 60.860 50.000 15.29 0.00 43.04 3.69
1178 1180 2.267642 CGGATTCCCCACGAGCAA 59.732 61.111 0.00 0.00 34.14 3.91
1349 1351 1.131315 GGATCTCTTTTCTGCAACGGC 59.869 52.381 0.00 0.00 41.68 5.68
1601 1607 1.346395 TCTACCACGGCTGACACATTT 59.654 47.619 0.00 0.00 0.00 2.32
1605 1611 2.224426 ACCACGGCTGACACATTTTCTA 60.224 45.455 0.00 0.00 0.00 2.10
2007 2013 2.226437 ACACTTTCAATGCGCGAAATCT 59.774 40.909 12.10 0.00 32.21 2.40
2035 2041 3.645884 AGTTAGCGTGCGAAACTTCTTA 58.354 40.909 9.04 0.00 29.25 2.10
2038 2044 3.293311 AGCGTGCGAAACTTCTTACTA 57.707 42.857 0.00 0.00 0.00 1.82
2248 2255 2.308722 GGATTGGGAGGAGGTGGCA 61.309 63.158 0.00 0.00 0.00 4.92
2293 2300 2.356125 CGAAATCTGTCCCTTCCCACAT 60.356 50.000 0.00 0.00 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 2.619931 CCCCCTTTTCCTTTGACCAAT 58.380 47.619 0.00 0.00 0.00 3.16
124 126 2.109181 GTCGGGCCTGATAGGTGC 59.891 66.667 19.55 0.00 37.80 5.01
142 144 4.379243 CAGCTCCGTGGACCGCTT 62.379 66.667 3.03 0.00 34.38 4.68
216 218 7.698912 TCTTTTTGGAAATGGGAAGATCTAGA 58.301 34.615 0.00 0.00 0.00 2.43
310 312 9.506018 TTGATCATAATGATATCGTGGAAATGT 57.494 29.630 0.00 0.00 37.20 2.71
326 328 7.038799 GGCCAAGTCCCATTAATTGATCATAAT 60.039 37.037 0.00 0.00 0.00 1.28
384 386 0.974383 CACCTGAAACGGGGACTACT 59.026 55.000 0.00 0.00 33.40 2.57
503 505 2.442236 ACGAGCAATGAATCCCCAAT 57.558 45.000 0.00 0.00 0.00 3.16
685 687 2.263741 CCAGTCCAGGCTTGTGCAC 61.264 63.158 10.75 10.75 41.91 4.57
686 688 2.113774 CCAGTCCAGGCTTGTGCA 59.886 61.111 0.00 0.00 41.91 4.57
1095 1097 1.415672 TTTGGAGGGCGAGGAGTGTT 61.416 55.000 0.00 0.00 0.00 3.32
1601 1607 3.460103 GTCGTTGGTCTTTGTGGTAGAA 58.540 45.455 0.00 0.00 0.00 2.10
1605 1611 0.464916 GGGTCGTTGGTCTTTGTGGT 60.465 55.000 0.00 0.00 0.00 4.16
2007 2013 0.318022 TCGCACGCTAACTCGAAACA 60.318 50.000 0.00 0.00 0.00 2.83
2020 2026 3.181543 GCTGTAGTAAGAAGTTTCGCACG 60.182 47.826 0.00 0.00 0.00 5.34
2035 2041 2.671396 CAGCGAATAAAACGGCTGTAGT 59.329 45.455 0.00 0.00 33.74 2.73
2038 2044 0.168128 GCAGCGAATAAAACGGCTGT 59.832 50.000 12.73 0.00 37.29 4.40
2248 2255 8.866093 TCGAATTCCTTTTTCCTTCCTTTTTAT 58.134 29.630 0.00 0.00 0.00 1.40
2293 2300 3.199946 AGGAAAGTCAAGCCCGATGATTA 59.800 43.478 0.00 0.00 0.00 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.