Multiple sequence alignment - TraesCS3A01G078000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G078000 chr3A 100.000 2249 0 0 1 2249 50435222 50437470 0 4154
1 TraesCS3A01G078000 chr3A 97.040 1081 29 3 1 1079 657439401 657440480 0 1816
2 TraesCS3A01G078000 chr6A 96.326 2259 73 7 1 2249 508000564 508002822 0 3703
3 TraesCS3A01G078000 chr6A 97.048 1084 27 4 1 1081 349779531 349780612 0 1820
4 TraesCS3A01G078000 chr1A 95.438 2258 80 9 1 2249 527084312 527082069 0 3578
5 TraesCS3A01G078000 chr2A 95.841 2116 78 5 144 2249 94221952 94224067 0 3411
6 TraesCS3A01G078000 chr2A 95.502 1712 74 3 1 1709 65084518 65086229 0 2732
7 TraesCS3A01G078000 chr5A 95.628 1830 70 5 430 2249 554347662 554349491 0 2928
8 TraesCS3A01G078000 chr5A 95.812 1361 50 2 896 2249 560882915 560881555 0 2191
9 TraesCS3A01G078000 chr6D 96.361 1649 53 4 1 1646 196357612 196359256 0 2706
10 TraesCS3A01G078000 chr7A 94.532 1591 76 8 381 1961 724636562 724638151 0 2446
11 TraesCS3A01G078000 chr6B 93.745 1359 74 6 901 2249 131761702 131760345 0 2028
12 TraesCS3A01G078000 chr1B 94.286 1050 51 4 1207 2249 552389895 552388848 0 1598
13 TraesCS3A01G078000 chr2D 94.983 897 38 2 1360 2249 464801694 464800798 0 1400


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G078000 chr3A 50435222 50437470 2248 False 4154 4154 100.000 1 2249 1 chr3A.!!$F1 2248
1 TraesCS3A01G078000 chr3A 657439401 657440480 1079 False 1816 1816 97.040 1 1079 1 chr3A.!!$F2 1078
2 TraesCS3A01G078000 chr6A 508000564 508002822 2258 False 3703 3703 96.326 1 2249 1 chr6A.!!$F2 2248
3 TraesCS3A01G078000 chr6A 349779531 349780612 1081 False 1820 1820 97.048 1 1081 1 chr6A.!!$F1 1080
4 TraesCS3A01G078000 chr1A 527082069 527084312 2243 True 3578 3578 95.438 1 2249 1 chr1A.!!$R1 2248
5 TraesCS3A01G078000 chr2A 94221952 94224067 2115 False 3411 3411 95.841 144 2249 1 chr2A.!!$F2 2105
6 TraesCS3A01G078000 chr2A 65084518 65086229 1711 False 2732 2732 95.502 1 1709 1 chr2A.!!$F1 1708
7 TraesCS3A01G078000 chr5A 554347662 554349491 1829 False 2928 2928 95.628 430 2249 1 chr5A.!!$F1 1819
8 TraesCS3A01G078000 chr5A 560881555 560882915 1360 True 2191 2191 95.812 896 2249 1 chr5A.!!$R1 1353
9 TraesCS3A01G078000 chr6D 196357612 196359256 1644 False 2706 2706 96.361 1 1646 1 chr6D.!!$F1 1645
10 TraesCS3A01G078000 chr7A 724636562 724638151 1589 False 2446 2446 94.532 381 1961 1 chr7A.!!$F1 1580
11 TraesCS3A01G078000 chr6B 131760345 131761702 1357 True 2028 2028 93.745 901 2249 1 chr6B.!!$R1 1348
12 TraesCS3A01G078000 chr1B 552388848 552389895 1047 True 1598 1598 94.286 1207 2249 1 chr1B.!!$R1 1042
13 TraesCS3A01G078000 chr2D 464800798 464801694 896 True 1400 1400 94.983 1360 2249 1 chr2D.!!$R1 889

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
113 114 1.140312 AGGGTTTGGTTCAGCTCTCA 58.860 50.000 0.0 0.0 0.0 3.27 F
937 949 1.875576 GCCGGTCTGATGGATTGCTAG 60.876 57.143 1.9 0.0 0.0 3.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1169 1181 0.172352 GTCGAGAAGAGAGCACCCAG 59.828 60.0 0.0 0.0 0.0 4.45 R
2173 2192 0.674581 TGGATTCACTCTGCCGCTTG 60.675 55.0 0.0 0.0 0.0 4.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 114 1.140312 AGGGTTTGGTTCAGCTCTCA 58.860 50.000 0.00 0.0 0.00 3.27
937 949 1.875576 GCCGGTCTGATGGATTGCTAG 60.876 57.143 1.90 0.0 0.00 3.42
1087 1099 2.264480 CGCCCTGGTCGTTCATCA 59.736 61.111 0.00 0.0 0.00 3.07
1104 1116 2.452600 TCACCTTTTCCTTTGCCAGT 57.547 45.000 0.00 0.0 0.00 4.00
1205 1217 1.336517 CGACTTACTCTGTTCCGCCAA 60.337 52.381 0.00 0.0 0.00 4.52
1233 1245 2.492449 TTCTCTCCGTGCTCTTGGCG 62.492 60.000 0.00 0.0 45.43 5.69
1354 1366 0.690192 TTCCTCGACTGAATTGGCCA 59.310 50.000 0.00 0.0 0.00 5.36
1424 1436 0.327924 TCCTGCATTACCACCACCAG 59.672 55.000 0.00 0.0 0.00 4.00
1433 1445 1.213296 ACCACCACCAGTCTTTCTGT 58.787 50.000 0.00 0.0 42.19 3.41
2173 2192 3.186001 CGCTGCAGGATAATGAGATGTTC 59.814 47.826 17.12 0.0 0.00 3.18
2229 2248 3.840890 TTGCACCGTTCCATTGAATAC 57.159 42.857 0.00 0.0 31.98 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
630 637 1.541147 CTTTTGGTGTCATGCCACGAT 59.459 47.619 0.03 0.00 36.16 3.73
937 949 2.178912 TAACCACCAACTAGCAGCAC 57.821 50.000 0.00 0.00 0.00 4.40
1087 1099 1.138859 GCAACTGGCAAAGGAAAAGGT 59.861 47.619 0.00 0.00 43.97 3.50
1104 1116 1.819208 CGCCGATCTCCCAATGCAA 60.819 57.895 0.00 0.00 0.00 4.08
1131 1143 1.971167 GTCAATGCGCCACCCTGAA 60.971 57.895 4.18 0.00 0.00 3.02
1169 1181 0.172352 GTCGAGAAGAGAGCACCCAG 59.828 60.000 0.00 0.00 0.00 4.45
1205 1217 1.338200 GCACGGAGAGAATCAACACCT 60.338 52.381 0.00 0.00 37.82 4.00
1354 1366 4.829492 AGCTTAGAGGCACAAAAGTCAATT 59.171 37.500 0.00 0.00 34.17 2.32
1424 1436 9.757227 AGCATTCAGATACTATTACAGAAAGAC 57.243 33.333 0.00 0.00 0.00 3.01
1433 1445 6.268617 AGAGTGGCAGCATTCAGATACTATTA 59.731 38.462 0.00 0.00 0.00 0.98
1448 1460 3.735029 GTGCAGCAGAGTGGCAGC 61.735 66.667 0.00 0.00 45.34 5.25
1724 1736 6.611642 ACATTATCCTACAGACCATGTGTAGT 59.388 38.462 16.50 8.34 44.02 2.73
2050 2069 9.528018 GAGAAAAGGACTAAGATTCTGATACAG 57.472 37.037 0.00 0.00 30.89 2.74
2173 2192 0.674581 TGGATTCACTCTGCCGCTTG 60.675 55.000 0.00 0.00 0.00 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.