Multiple sequence alignment - TraesCS3A01G077200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G077200 chr3A 100.000 2273 0 0 1 2273 48445133 48447405 0.000000e+00 4198.0
1 TraesCS3A01G077200 chr3A 97.893 2278 23 6 1 2273 48365715 48367972 0.000000e+00 3917.0
2 TraesCS3A01G077200 chr3A 90.226 972 58 10 1305 2273 49463473 49464410 0.000000e+00 1234.0
3 TraesCS3A01G077200 chr3A 95.522 67 3 0 3 69 294133726 294133792 8.590000e-20 108.0
4 TraesCS3A01G077200 chr3A 95.082 61 3 0 113 173 49463394 49463454 1.860000e-16 97.1
5 TraesCS3A01G077200 chr6A 95.435 1139 50 2 172 1309 27563855 27562718 0.000000e+00 1814.0
6 TraesCS3A01G077200 chr4D 92.035 1130 90 0 172 1301 261360052 261358923 0.000000e+00 1589.0
7 TraesCS3A01G077200 chr4D 81.810 1138 194 12 173 1303 20529688 20530819 0.000000e+00 942.0
8 TraesCS3A01G077200 chr2B 89.534 1137 113 5 172 1306 789543055 789541923 0.000000e+00 1435.0
9 TraesCS3A01G077200 chr7B 88.163 1132 127 7 172 1301 713141637 713142763 0.000000e+00 1341.0
10 TraesCS3A01G077200 chr7B 88.095 84 8 2 1 83 579282528 579282446 5.170000e-17 99.0
11 TraesCS3A01G077200 chr1B 87.687 1137 129 6 172 1307 668197997 668196871 0.000000e+00 1314.0
12 TraesCS3A01G077200 chr1B 87.980 990 119 0 179 1168 360982409 360983398 0.000000e+00 1170.0
13 TraesCS3A01G077200 chr1B 90.164 244 20 4 1062 1302 142290849 142291091 4.710000e-82 315.0
14 TraesCS3A01G077200 chr3D 90.647 973 78 8 1305 2273 38012122 38013085 0.000000e+00 1280.0
15 TraesCS3A01G077200 chr3B 91.309 909 64 6 1369 2273 60641745 60642642 0.000000e+00 1227.0
16 TraesCS3A01G077200 chr3B 92.632 95 7 0 1637 1731 60711090 60710996 1.090000e-28 137.0
17 TraesCS3A01G077200 chr5A 82.759 1044 169 10 271 1307 440976031 440974992 0.000000e+00 920.0
18 TraesCS3A01G077200 chrUn 74.118 595 136 14 1636 2224 255562799 255563381 1.760000e-56 230.0
19 TraesCS3A01G077200 chr6D 94.203 69 3 1 1 69 4073579 4073512 1.110000e-18 104.0
20 TraesCS3A01G077200 chr7D 96.667 60 2 0 1 60 236009904 236009963 1.440000e-17 100.0
21 TraesCS3A01G077200 chr1A 90.541 74 6 1 1 74 295455255 295455183 1.860000e-16 97.1
22 TraesCS3A01G077200 chr1A 90.541 74 6 1 1 74 295455978 295455906 1.860000e-16 97.1
23 TraesCS3A01G077200 chr1A 84.524 84 10 3 33 113 581605745 581605828 1.870000e-11 80.5
24 TraesCS3A01G077200 chr5B 95.349 43 1 1 22 64 418548130 418548171 1.460000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G077200 chr3A 48445133 48447405 2272 False 4198.00 4198 100.000 1 2273 1 chr3A.!!$F2 2272
1 TraesCS3A01G077200 chr3A 48365715 48367972 2257 False 3917.00 3917 97.893 1 2273 1 chr3A.!!$F1 2272
2 TraesCS3A01G077200 chr3A 49463394 49464410 1016 False 665.55 1234 92.654 113 2273 2 chr3A.!!$F4 2160
3 TraesCS3A01G077200 chr6A 27562718 27563855 1137 True 1814.00 1814 95.435 172 1309 1 chr6A.!!$R1 1137
4 TraesCS3A01G077200 chr4D 261358923 261360052 1129 True 1589.00 1589 92.035 172 1301 1 chr4D.!!$R1 1129
5 TraesCS3A01G077200 chr4D 20529688 20530819 1131 False 942.00 942 81.810 173 1303 1 chr4D.!!$F1 1130
6 TraesCS3A01G077200 chr2B 789541923 789543055 1132 True 1435.00 1435 89.534 172 1306 1 chr2B.!!$R1 1134
7 TraesCS3A01G077200 chr7B 713141637 713142763 1126 False 1341.00 1341 88.163 172 1301 1 chr7B.!!$F1 1129
8 TraesCS3A01G077200 chr1B 668196871 668197997 1126 True 1314.00 1314 87.687 172 1307 1 chr1B.!!$R1 1135
9 TraesCS3A01G077200 chr1B 360982409 360983398 989 False 1170.00 1170 87.980 179 1168 1 chr1B.!!$F2 989
10 TraesCS3A01G077200 chr3D 38012122 38013085 963 False 1280.00 1280 90.647 1305 2273 1 chr3D.!!$F1 968
11 TraesCS3A01G077200 chr3B 60641745 60642642 897 False 1227.00 1227 91.309 1369 2273 1 chr3B.!!$F1 904
12 TraesCS3A01G077200 chr5A 440974992 440976031 1039 True 920.00 920 82.759 271 1307 1 chr5A.!!$R1 1036
13 TraesCS3A01G077200 chrUn 255562799 255563381 582 False 230.00 230 74.118 1636 2224 1 chrUn.!!$F1 588

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
562 563 1.308069 CGGCTTACCACAGCTGCATT 61.308 55.0 15.27 0.0 39.32 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1565 1590 0.324091 AGGACCGTCGGTGGATAGTT 60.324 55.0 24.45 0.0 35.25 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
282 283 4.551671 AGCATAGCTCTTTAGAGGAAGGA 58.448 43.478 8.73 0.00 42.29 3.36
394 395 2.485124 CGAGTACTCCGTGGGATACTCT 60.485 54.545 17.23 5.97 38.77 3.24
562 563 1.308069 CGGCTTACCACAGCTGCATT 61.308 55.000 15.27 0.00 39.32 3.56
991 995 2.808543 GCTCAGTTTCGTGGTTTCTCAT 59.191 45.455 0.00 0.00 0.00 2.90
1064 1068 1.457346 GGCAACTCCAGATCTGTTGG 58.543 55.000 21.11 12.47 40.72 3.77
1565 1590 3.965379 TGTTCCCAGCTTATCGTGTTA 57.035 42.857 0.00 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 5.841810 TGTTTGGTCCATCAGATGTTTTTC 58.158 37.500 9.64 0.00 0.00 2.29
11 12 4.577693 CCACTATGTTTGGTCCATCAGATG 59.422 45.833 3.04 3.04 0.00 2.90
174 175 1.839994 CAGGCCAAAGTATCCTCTCCA 59.160 52.381 5.01 0.00 0.00 3.86
282 283 2.165641 TGATGATGCTTCGGTAGTCGTT 59.834 45.455 0.00 0.00 40.32 3.85
394 395 6.036408 CGATATTGCAAGTTGACAGAATCTGA 59.964 38.462 18.20 0.00 35.18 3.27
544 545 0.453390 GAATGCAGCTGTGGTAAGCC 59.547 55.000 16.64 0.00 44.68 4.35
562 563 4.002506 ACGAGCCCATGTGTGCGA 62.003 61.111 0.00 0.00 0.00 5.10
796 800 2.288457 CGGTATTGATCGTGATCCAGCT 60.288 50.000 7.36 0.00 37.02 4.24
991 995 6.156083 TGACAGTCAACCTCCATTATCACATA 59.844 38.462 0.00 0.00 0.00 2.29
1064 1068 6.448006 TCTAACTCAATTAAGATAGGCGCTC 58.552 40.000 7.64 0.00 0.00 5.03
1565 1590 0.324091 AGGACCGTCGGTGGATAGTT 60.324 55.000 24.45 0.00 35.25 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.