Multiple sequence alignment - TraesCS3A01G071300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G071300 chr3A 100.000 3398 0 0 1 3398 44219712 44216315 0.000000e+00 6276.0
1 TraesCS3A01G071300 chr3A 99.559 3398 15 0 1 3398 43013368 43009971 0.000000e+00 6192.0
2 TraesCS3A01G071300 chr3A 99.264 3399 21 2 1 3398 43636612 43633217 0.000000e+00 6135.0
3 TraesCS3A01G071300 chr3A 76.744 344 69 9 2851 3187 28894969 28895308 7.490000e-42 182.0
4 TraesCS3A01G071300 chr7D 79.104 335 54 13 2863 3187 364107767 364107439 2.050000e-52 217.0
5 TraesCS3A01G071300 chr5B 79.876 323 44 18 2863 3172 219085316 219085002 2.050000e-52 217.0
6 TraesCS3A01G071300 chr5B 76.807 332 67 8 2863 3187 58672490 58672162 9.690000e-41 178.0
7 TraesCS3A01G071300 chr2D 77.616 344 64 12 2851 3186 540636597 540636259 2.670000e-46 196.0
8 TraesCS3A01G071300 chr4D 77.709 323 59 12 2852 3166 383896018 383896335 5.790000e-43 185.0
9 TraesCS3A01G071300 chr4D 76.945 347 63 12 2851 3187 396744753 396745092 7.490000e-42 182.0
10 TraesCS3A01G071300 chr1D 85.625 160 17 4 771 926 419478125 419477968 2.710000e-36 163.0
11 TraesCS3A01G071300 chr5D 85.065 154 18 3 769 917 461072610 461072763 5.870000e-33 152.0
12 TraesCS3A01G071300 chr7A 84.615 156 18 4 771 920 124796028 124795873 2.110000e-32 150.0
13 TraesCS3A01G071300 chr1B 84.868 152 20 2 769 917 67537451 67537602 2.110000e-32 150.0
14 TraesCS3A01G071300 chr2B 84.177 158 19 2 769 920 797329810 797329967 7.600000e-32 148.0
15 TraesCS3A01G071300 chr5A 84.416 154 19 1 769 917 320214252 320214405 2.730000e-31 147.0
16 TraesCS3A01G071300 chr3D 83.766 154 20 1 769 917 598889740 598889893 1.270000e-29 141.0
17 TraesCS3A01G071300 chr7B 82.222 90 9 7 1796 1884 616834786 616834703 1.690000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G071300 chr3A 44216315 44219712 3397 True 6276 6276 100.000 1 3398 1 chr3A.!!$R3 3397
1 TraesCS3A01G071300 chr3A 43009971 43013368 3397 True 6192 6192 99.559 1 3398 1 chr3A.!!$R1 3397
2 TraesCS3A01G071300 chr3A 43633217 43636612 3395 True 6135 6135 99.264 1 3398 1 chr3A.!!$R2 3397

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1466 1468 5.496133 TGCACTCTTCCGATACTTAGTAC 57.504 43.478 0.0 0.0 0.0 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3195 3197 4.365514 TCCAAAACATCACCTCAAGCTA 57.634 40.909 0.0 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1466 1468 5.496133 TGCACTCTTCCGATACTTAGTAC 57.504 43.478 0.0 0.0 0.0 2.73
2033 2035 5.653769 TGCCCTTTCTCAAATTCTCATAAGG 59.346 40.000 0.0 0.0 0.0 2.69
3071 3073 1.209261 TCCGAAGATTATGCTGCCACA 59.791 47.619 0.0 0.0 0.0 4.17
3072 3074 2.158769 TCCGAAGATTATGCTGCCACAT 60.159 45.455 0.0 0.0 0.0 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1466 1468 8.522542 AGTACCATGTTCTAGTAAGTAAGAGG 57.477 38.462 0.00 0.0 0.00 3.69
2033 2035 5.856126 TCAATTGACATACAACGGTCTTC 57.144 39.130 3.38 0.0 41.52 2.87
3071 3073 5.719563 CCAAGGAGGTTTTTACCCAACATAT 59.280 40.000 0.00 0.0 0.00 1.78
3072 3074 5.081032 CCAAGGAGGTTTTTACCCAACATA 58.919 41.667 0.00 0.0 0.00 2.29
3195 3197 4.365514 TCCAAAACATCACCTCAAGCTA 57.634 40.909 0.00 0.0 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.