Multiple sequence alignment - TraesCS3A01G070900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G070900 chr3A 100.000 2988 0 0 1 2988 43013368 43010381 0.000000e+00 5518.0
1 TraesCS3A01G070900 chr3A 99.665 2988 10 0 1 2988 44219712 44216725 0.000000e+00 5463.0
2 TraesCS3A01G070900 chr3A 99.164 2989 21 2 1 2988 43636612 43633627 0.000000e+00 5378.0
3 TraesCS3A01G070900 chr1D 85.625 160 17 4 771 926 419478125 419477968 2.380000e-36 163.0
4 TraesCS3A01G070900 chr5D 85.065 154 18 3 769 917 461072610 461072763 5.160000e-33 152.0
5 TraesCS3A01G070900 chr7A 84.615 156 18 4 771 920 124796028 124795873 1.860000e-32 150.0
6 TraesCS3A01G070900 chr1B 84.868 152 20 2 769 917 67537451 67537602 1.860000e-32 150.0
7 TraesCS3A01G070900 chr2B 84.177 158 19 2 769 920 797329810 797329967 6.670000e-32 148.0
8 TraesCS3A01G070900 chr5A 84.416 154 19 1 769 917 320214252 320214405 2.400000e-31 147.0
9 TraesCS3A01G070900 chr5A 95.833 48 2 0 2862 2909 600375073 600375026 8.880000e-11 78.7
10 TraesCS3A01G070900 chr5A 84.337 83 5 7 2862 2939 14375208 14375129 1.150000e-09 75.0
11 TraesCS3A01G070900 chr3D 83.766 154 20 1 769 917 598889740 598889893 1.120000e-29 141.0
12 TraesCS3A01G070900 chr5B 84.921 126 10 9 2863 2982 219085316 219085194 5.230000e-23 119.0
13 TraesCS3A01G070900 chr5B 86.408 103 8 6 2851 2950 147424358 147424457 1.130000e-19 108.0
14 TraesCS3A01G070900 chr6D 82.308 130 15 8 2864 2988 458504483 458504357 4.070000e-19 106.0
15 TraesCS3A01G070900 chr4A 83.333 114 12 6 2877 2986 581918342 581918452 6.820000e-17 99.0
16 TraesCS3A01G070900 chr7D 86.207 58 8 0 2852 2909 567709048 567709105 2.490000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G070900 chr3A 43010381 43013368 2987 True 5518 5518 100.000 1 2988 1 chr3A.!!$R1 2987
1 TraesCS3A01G070900 chr3A 44216725 44219712 2987 True 5463 5463 99.665 1 2988 1 chr3A.!!$R3 2987
2 TraesCS3A01G070900 chr3A 43633627 43636612 2985 True 5378 5378 99.164 1 2988 1 chr3A.!!$R2 2987

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 1847 4.790766 GCTCGCTCACATAAATCCATTTGG 60.791 45.833 0.0 0.0 0.0 3.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2879 2881 4.881273 TGCTTTGTATCCGTTTGATGCTAT 59.119 37.5 0.0 0.0 37.04 2.97 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1845 1847 4.790766 GCTCGCTCACATAAATCCATTTGG 60.791 45.833 0.00 0.00 0.00 3.28
1859 1861 3.906846 TCCATTTGGGCCACAAGTAATTT 59.093 39.130 5.23 0.00 40.82 1.82
2314 2316 9.872721 TCGTTTATGTAAATAAGTATGACACCA 57.127 29.630 0.00 0.00 0.00 4.17
2722 2724 3.820467 TGGAACTAAATGAACAGCACCAG 59.180 43.478 0.00 0.00 0.00 4.00
2961 2963 0.098025 CAGCCAAACACGAACGTTGT 59.902 50.000 5.00 0.98 0.00 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1845 1847 1.201414 CGTCCCAAATTACTTGTGGCC 59.799 52.381 0.0 0.0 32.65 5.36
1859 1861 0.554305 TAGATACTGCCTCCGTCCCA 59.446 55.000 0.0 0.0 0.00 4.37
2879 2881 4.881273 TGCTTTGTATCCGTTTGATGCTAT 59.119 37.500 0.0 0.0 37.04 2.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.