Multiple sequence alignment - TraesCS3A01G069500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G069500 chr3A 100.000 2246 0 0 1 2246 41657032 41659277 0.000000e+00 4148
1 TraesCS3A01G069500 chr3A 96.014 2032 50 9 6 2013 743242959 743240935 0.000000e+00 3275
2 TraesCS3A01G069500 chr3A 95.429 875 22 4 1 857 433764053 433764927 0.000000e+00 1378
3 TraesCS3A01G069500 chr3A 90.787 890 48 5 6 862 575149186 575150074 0.000000e+00 1158
4 TraesCS3A01G069500 chr3A 93.488 430 10 2 1 414 697161603 697162030 6.810000e-175 623
5 TraesCS3A01G069500 chr6A 96.520 2270 33 9 1 2246 616335749 616333502 0.000000e+00 3712
6 TraesCS3A01G069500 chr2A 96.311 2033 49 5 1 2010 708688383 708690412 0.000000e+00 3315
7 TraesCS3A01G069500 chr2A 96.116 2034 53 5 1 2010 88834911 88836942 0.000000e+00 3295
8 TraesCS3A01G069500 chr7A 95.633 2038 51 6 1 2013 106589982 106587958 0.000000e+00 3236
9 TraesCS3A01G069500 chr7A 95.387 1344 37 3 1 1321 647417623 647416282 0.000000e+00 2115
10 TraesCS3A01G069500 chr7A 95.455 858 22 1 6 846 617961191 617960334 0.000000e+00 1352
11 TraesCS3A01G069500 chr4A 95.359 1616 53 5 1 1597 630614335 630612723 0.000000e+00 2549
12 TraesCS3A01G069500 chr4A 96.791 1340 37 2 264 1597 587723613 587724952 0.000000e+00 2231
13 TraesCS3A01G069500 chr4A 97.973 148 3 0 1866 2013 345850436 345850289 7.960000e-65 257
14 TraesCS3A01G069500 chr1A 96.523 1323 39 3 1 1318 287039072 287040392 0.000000e+00 2182
15 TraesCS3A01G069500 chr1A 98.723 235 3 0 2012 2246 573925278 573925044 3.450000e-113 418
16 TraesCS3A01G069500 chr4B 97.989 547 9 2 1320 1865 559905700 559905155 0.000000e+00 948
17 TraesCS3A01G069500 chr5B 97.806 547 10 2 1320 1865 57786918 57787463 0.000000e+00 942
18 TraesCS3A01G069500 chr5D 97.973 148 3 0 1863 2010 391944512 391944659 7.960000e-65 257
19 TraesCS3A01G069500 chr1D 95.181 83 4 0 2164 2246 477483754 477483672 5.030000e-27 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G069500 chr3A 41657032 41659277 2245 False 4148 4148 100.000 1 2246 1 chr3A.!!$F1 2245
1 TraesCS3A01G069500 chr3A 743240935 743242959 2024 True 3275 3275 96.014 6 2013 1 chr3A.!!$R1 2007
2 TraesCS3A01G069500 chr3A 433764053 433764927 874 False 1378 1378 95.429 1 857 1 chr3A.!!$F2 856
3 TraesCS3A01G069500 chr3A 575149186 575150074 888 False 1158 1158 90.787 6 862 1 chr3A.!!$F3 856
4 TraesCS3A01G069500 chr6A 616333502 616335749 2247 True 3712 3712 96.520 1 2246 1 chr6A.!!$R1 2245
5 TraesCS3A01G069500 chr2A 708688383 708690412 2029 False 3315 3315 96.311 1 2010 1 chr2A.!!$F2 2009
6 TraesCS3A01G069500 chr2A 88834911 88836942 2031 False 3295 3295 96.116 1 2010 1 chr2A.!!$F1 2009
7 TraesCS3A01G069500 chr7A 106587958 106589982 2024 True 3236 3236 95.633 1 2013 1 chr7A.!!$R1 2012
8 TraesCS3A01G069500 chr7A 647416282 647417623 1341 True 2115 2115 95.387 1 1321 1 chr7A.!!$R3 1320
9 TraesCS3A01G069500 chr7A 617960334 617961191 857 True 1352 1352 95.455 6 846 1 chr7A.!!$R2 840
10 TraesCS3A01G069500 chr4A 630612723 630614335 1612 True 2549 2549 95.359 1 1597 1 chr4A.!!$R2 1596
11 TraesCS3A01G069500 chr4A 587723613 587724952 1339 False 2231 2231 96.791 264 1597 1 chr4A.!!$F1 1333
12 TraesCS3A01G069500 chr1A 287039072 287040392 1320 False 2182 2182 96.523 1 1318 1 chr1A.!!$F1 1317
13 TraesCS3A01G069500 chr4B 559905155 559905700 545 True 948 948 97.989 1320 1865 1 chr4B.!!$R1 545
14 TraesCS3A01G069500 chr5B 57786918 57787463 545 False 942 942 97.806 1320 1865 1 chr5B.!!$F1 545

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
419 458 0.843309 TTCACTTCTTGGAGCCCACA 59.157 50.0 0.0 0.0 30.78 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2095 2147 0.716108 GACGCTTCATCGAACACAGG 59.284 55.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
419 458 0.843309 TTCACTTCTTGGAGCCCACA 59.157 50.000 0.00 0.0 30.78 4.17
1051 1099 6.668323 CAAAGAAAAAGCGATTACCTCTCAA 58.332 36.000 0.00 0.0 0.00 3.02
1188 1236 4.070716 CAGCAAACAGGAAGAATCAGAGT 58.929 43.478 0.00 0.0 0.00 3.24
1318 1366 6.239217 ACAGTATTCAGAGCATCATTACCA 57.761 37.500 0.00 0.0 37.82 3.25
1393 1441 0.251787 GGGAGGGATTGCAACAAGGT 60.252 55.000 0.00 0.0 0.00 3.50
1490 1538 2.362503 TCGATCTGGCCACCGTCT 60.363 61.111 0.00 0.0 0.00 4.18
1737 1787 5.392380 GGCAAGTTACAATCCATCTGTCAAG 60.392 44.000 0.00 0.0 0.00 3.02
2010 2062 5.064198 GGTTGTTTCTAATGCGTGCATACTA 59.936 40.000 7.91 0.0 35.31 1.82
2082 2134 0.249911 ACCCACTTGCTTCTCACGTC 60.250 55.000 0.00 0.0 0.00 4.34
2095 2147 1.321743 CTCACGTCGCTCTAATTGTGC 59.678 52.381 0.00 0.0 0.00 4.57
2192 2244 1.461127 GATCGTGAGTTGTGAAGGTGC 59.539 52.381 0.00 0.0 0.00 5.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
419 458 5.464057 TGATGTACTTCATTCGTGTTTCGTT 59.536 36.000 7.33 0.00 37.58 3.85
801 841 5.979288 ACCCGATCAGTATGTATACTTCC 57.021 43.478 4.17 0.00 41.44 3.46
1188 1236 0.108472 CTTCATGCTGGCTCGACTGA 60.108 55.000 0.00 0.00 0.00 3.41
1318 1366 3.447950 AGGTACCCGTGATTAACCTCTT 58.552 45.455 8.74 0.00 35.67 2.85
1393 1441 2.564771 GCATCATCAAGGTTCGATCCA 58.435 47.619 14.83 0.00 0.00 3.41
1490 1538 3.924013 ATGGGCCTCGACCTCCACA 62.924 63.158 4.53 0.00 31.48 4.17
1737 1787 3.198068 TCTGGCAGATGAGCGATTTTAC 58.802 45.455 14.43 0.00 34.64 2.01
2010 2062 1.901159 TGGCCAATGCTTAGCAATGTT 59.099 42.857 19.25 3.73 43.62 2.71
2082 2134 1.442769 ACACAGGCACAATTAGAGCG 58.557 50.000 0.00 0.00 34.34 5.03
2095 2147 0.716108 GACGCTTCATCGAACACAGG 59.284 55.000 0.00 0.00 0.00 4.00
2192 2244 3.120546 CCACACTTGTGTTAAGATCTGCG 60.121 47.826 8.52 0.00 44.21 5.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.