Multiple sequence alignment - TraesCS3A01G053000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G053000 chr3A 100.000 2546 0 0 1 2546 29047477 29050022 0.000000e+00 4702.0
1 TraesCS3A01G053000 chr3A 97.154 1827 51 1 719 2545 29352377 29350552 0.000000e+00 3085.0
2 TraesCS3A01G053000 chr3A 92.928 905 43 4 1596 2479 29065215 29066119 0.000000e+00 1297.0
3 TraesCS3A01G053000 chr3A 97.982 545 11 0 687 1231 29064677 29065221 0.000000e+00 946.0
4 TraesCS3A01G053000 chr7A 98.542 686 9 1 2 687 701614356 701615040 0.000000e+00 1210.0
5 TraesCS3A01G053000 chr7A 98.108 687 11 2 2 688 643671545 643672229 0.000000e+00 1195.0
6 TraesCS3A01G053000 chr7A 90.994 322 23 6 2 321 40874219 40874536 1.810000e-116 429.0
7 TraesCS3A01G053000 chr7A 94.828 58 3 0 1973 2030 229277640 229277583 9.700000e-15 91.6
8 TraesCS3A01G053000 chr2A 98.256 688 9 3 3 688 739297290 739297976 0.000000e+00 1201.0
9 TraesCS3A01G053000 chr2A 94.253 174 6 2 515 688 735570548 735570379 1.940000e-66 263.0
10 TraesCS3A01G053000 chr2A 93.064 173 11 1 353 525 762286118 762286289 4.200000e-63 252.0
11 TraesCS3A01G053000 chr2A 76.047 430 86 10 1970 2395 128477545 128477961 9.230000e-50 207.0
12 TraesCS3A01G053000 chr7B 97.388 689 17 1 2 689 61301 60613 0.000000e+00 1171.0
13 TraesCS3A01G053000 chr7B 77.193 399 77 8 1970 2364 495161517 495161905 1.190000e-53 220.0
14 TraesCS3A01G053000 chrUn 84.371 851 112 15 978 1814 43664687 43665530 0.000000e+00 815.0
15 TraesCS3A01G053000 chrUn 79.777 717 132 11 999 1704 44529588 44528874 2.260000e-140 508.0
16 TraesCS3A01G053000 chrUn 83.654 520 78 6 978 1491 168641904 168641386 1.370000e-132 483.0
17 TraesCS3A01G053000 chrUn 88.816 152 16 1 1670 1821 43771096 43771246 4.330000e-43 185.0
18 TraesCS3A01G053000 chr6A 98.580 352 5 0 2 353 606533184 606532833 7.740000e-175 623.0
19 TraesCS3A01G053000 chr6A 97.917 336 7 0 352 687 606527625 606527290 1.310000e-162 582.0
20 TraesCS3A01G053000 chr6A 78.689 305 50 9 1978 2277 46786504 46786798 3.340000e-44 189.0
21 TraesCS3A01G053000 chr3B 85.507 483 64 5 996 1476 35574002 35574480 1.360000e-137 499.0
22 TraesCS3A01G053000 chr3B 84.661 502 73 4 978 1476 35212259 35212759 4.890000e-137 497.0
23 TraesCS3A01G053000 chr3B 84.661 502 73 4 978 1476 35288443 35288943 4.890000e-137 497.0
24 TraesCS3A01G053000 chr3B 85.300 483 65 5 996 1476 35461792 35462270 6.330000e-136 494.0
25 TraesCS3A01G053000 chr3B 84.431 501 72 5 996 1494 34522530 34522034 2.940000e-134 488.0
26 TraesCS3A01G053000 chr3D 79.862 581 108 8 1970 2546 488885754 488886329 1.410000e-112 416.0
27 TraesCS3A01G053000 chr3D 76.250 560 107 12 1947 2501 350665080 350665618 8.970000e-70 274.0
28 TraesCS3A01G053000 chr5D 77.521 605 130 5 1946 2546 565513250 565512648 2.410000e-95 359.0
29 TraesCS3A01G053000 chr5B 92.935 184 8 3 515 697 637390273 637390094 1.940000e-66 263.0
30 TraesCS3A01G053000 chr5B 90.909 44 3 1 2310 2353 493535329 493535287 9.840000e-05 58.4
31 TraesCS3A01G053000 chr4A 94.220 173 6 2 515 687 587308850 587309018 6.990000e-66 261.0
32 TraesCS3A01G053000 chr1B 94.220 173 6 2 515 687 687256160 687256328 6.990000e-66 261.0
33 TraesCS3A01G053000 chr1B 88.889 63 5 2 1814 1875 604327188 604327249 2.720000e-10 76.8
34 TraesCS3A01G053000 chr4D 79.124 388 67 8 1973 2355 150978417 150978039 3.250000e-64 255.0
35 TraesCS3A01G053000 chr2D 94.012 167 10 0 352 518 637657255 637657089 1.170000e-63 254.0
36 TraesCS3A01G053000 chr2B 94.012 167 10 0 352 518 795070182 795070016 1.170000e-63 254.0
37 TraesCS3A01G053000 chr6B 77.273 396 75 9 1973 2364 26888200 26888584 4.260000e-53 219.0
38 TraesCS3A01G053000 chr7D 94.000 50 2 1 1820 1868 34751268 34751219 9.770000e-10 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G053000 chr3A 29047477 29050022 2545 False 4702.0 4702 100.000 1 2546 1 chr3A.!!$F1 2545
1 TraesCS3A01G053000 chr3A 29350552 29352377 1825 True 3085.0 3085 97.154 719 2545 1 chr3A.!!$R1 1826
2 TraesCS3A01G053000 chr3A 29064677 29066119 1442 False 1121.5 1297 95.455 687 2479 2 chr3A.!!$F2 1792
3 TraesCS3A01G053000 chr7A 701614356 701615040 684 False 1210.0 1210 98.542 2 687 1 chr7A.!!$F3 685
4 TraesCS3A01G053000 chr7A 643671545 643672229 684 False 1195.0 1195 98.108 2 688 1 chr7A.!!$F2 686
5 TraesCS3A01G053000 chr2A 739297290 739297976 686 False 1201.0 1201 98.256 3 688 1 chr2A.!!$F2 685
6 TraesCS3A01G053000 chr7B 60613 61301 688 True 1171.0 1171 97.388 2 689 1 chr7B.!!$R1 687
7 TraesCS3A01G053000 chrUn 43664687 43665530 843 False 815.0 815 84.371 978 1814 1 chrUn.!!$F1 836
8 TraesCS3A01G053000 chrUn 44528874 44529588 714 True 508.0 508 79.777 999 1704 1 chrUn.!!$R1 705
9 TraesCS3A01G053000 chrUn 168641386 168641904 518 True 483.0 483 83.654 978 1491 1 chrUn.!!$R2 513
10 TraesCS3A01G053000 chr3B 35212259 35212759 500 False 497.0 497 84.661 978 1476 1 chr3B.!!$F1 498
11 TraesCS3A01G053000 chr3B 35288443 35288943 500 False 497.0 497 84.661 978 1476 1 chr3B.!!$F2 498
12 TraesCS3A01G053000 chr3D 488885754 488886329 575 False 416.0 416 79.862 1970 2546 1 chr3D.!!$F2 576
13 TraesCS3A01G053000 chr3D 350665080 350665618 538 False 274.0 274 76.250 1947 2501 1 chr3D.!!$F1 554
14 TraesCS3A01G053000 chr5D 565512648 565513250 602 True 359.0 359 77.521 1946 2546 1 chr5D.!!$R1 600

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
805 809 0.179032 AGCCACGAATCAACCACACA 60.179 50.0 0.0 0.0 0.0 3.72 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2474 2538 1.078214 CCCAAGCTCAGGCGATTCA 60.078 57.895 0.0 0.0 44.37 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
390 392 3.945921 AGAAATGTGCTCCAGATGTCATG 59.054 43.478 0.00 0.00 0.00 3.07
410 412 3.096092 TGCTGGTGGAGAAAACAGTTTT 58.904 40.909 11.22 11.22 33.62 2.43
805 809 0.179032 AGCCACGAATCAACCACACA 60.179 50.000 0.00 0.00 0.00 3.72
921 925 5.180492 TCAACCGAATCTAACATCCAACAAC 59.820 40.000 0.00 0.00 0.00 3.32
1040 1044 3.512680 CCTCTACGAAACTCATCACCAC 58.487 50.000 0.00 0.00 0.00 4.16
1182 1187 1.209261 TGGCGACAATGCTCCTCATAA 59.791 47.619 0.00 0.00 37.44 1.90
1568 1594 5.923733 ATAAACGTTCTGACCTGATCTCT 57.076 39.130 0.00 0.00 0.00 3.10
1634 1660 1.134907 CCGGCCACTGTCGTACTATTT 60.135 52.381 2.24 0.00 38.09 1.40
2356 2420 2.422832 GACGACGATCTCCTACTTGGTT 59.577 50.000 0.00 0.00 37.07 3.67
2401 2465 1.682684 CGGGCTAGGAGAGTGTGGT 60.683 63.158 0.00 0.00 0.00 4.16
2474 2538 4.043168 CGGAGCACCACGACTTTT 57.957 55.556 0.00 0.00 35.59 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
266 268 3.084039 AGCCTCAAAATCATGCTCGAAA 58.916 40.909 0.00 0.00 0.00 3.46
390 392 3.447742 CAAAACTGTTTTCTCCACCAGC 58.552 45.455 15.17 0.00 0.00 4.85
410 412 4.175337 GCTCCTGTATGCCCCGCA 62.175 66.667 0.00 0.00 44.86 5.69
921 925 7.661040 AGTGGGAGTCAGAACATAAATTTTTG 58.339 34.615 7.04 7.04 0.00 2.44
970 974 3.261981 CCAACATGGTACCACCTACTC 57.738 52.381 19.09 0.00 39.58 2.59
1257 1262 4.988598 CGCAGACGGGTTGGCACT 62.989 66.667 0.00 0.00 34.97 4.40
1491 1499 2.738139 CGGATGGCGCGATATGCA 60.738 61.111 12.10 0.00 46.97 3.96
1568 1594 2.501723 GCACTCCTTTCTCCCTCACATA 59.498 50.000 0.00 0.00 0.00 2.29
1634 1660 5.923733 TGGGAGTGAAAGTAAAAAGCAAA 57.076 34.783 0.00 0.00 0.00 3.68
1742 1780 6.882140 TCTCACGGTTGTTATGTGGATTAAAT 59.118 34.615 0.00 0.00 34.43 1.40
1747 1785 3.513912 TCTCTCACGGTTGTTATGTGGAT 59.486 43.478 0.00 0.00 34.43 3.41
2474 2538 1.078214 CCCAAGCTCAGGCGATTCA 60.078 57.895 0.00 0.00 44.37 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.