Multiple sequence alignment - TraesCS3A01G052800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G052800 chr3A 100.000 2660 0 0 1 2660 28628889 28626230 0.000000e+00 4913.0
1 TraesCS3A01G052800 chr3A 98.781 2625 27 5 1 2624 28738038 28735418 0.000000e+00 4665.0
2 TraesCS3A01G052800 chr3A 98.590 2625 36 1 1 2624 28672429 28669805 0.000000e+00 4641.0
3 TraesCS3A01G052800 chr3A 100.000 37 0 0 2624 2660 28669782 28669746 4.750000e-08 69.4
4 TraesCS3A01G052800 chr3A 100.000 37 0 0 2624 2660 28735395 28735359 4.750000e-08 69.4
5 TraesCS3A01G052800 chr3B 93.130 2489 163 4 48 2530 34151482 34148996 0.000000e+00 3642.0
6 TraesCS3A01G052800 chr3B 92.335 1683 123 2 48 1729 34196389 34194712 0.000000e+00 2388.0
7 TraesCS3A01G052800 chr3B 92.036 1645 129 2 48 1691 34011226 34009583 0.000000e+00 2311.0
8 TraesCS3A01G052800 chr3B 86.641 1048 117 12 910 1951 34055241 34054211 0.000000e+00 1138.0
9 TraesCS3A01G052800 chr3B 92.090 670 42 3 1963 2624 34009215 34008549 0.000000e+00 933.0
10 TraesCS3A01G052800 chr3B 93.821 615 32 2 1880 2489 34203513 34202900 0.000000e+00 920.0
11 TraesCS3A01G052800 chr3B 89.877 405 37 4 2197 2599 34053950 34053548 3.930000e-143 518.0
12 TraesCS3A01G052800 chr3B 88.716 257 13 2 1753 2001 34009464 34009216 1.550000e-77 300.0
13 TraesCS3A01G052800 chrUn 94.143 1878 103 3 618 2489 366591618 366589742 0.000000e+00 2852.0
14 TraesCS3A01G052800 chrUn 94.493 1253 63 2 1242 2489 419983405 419984656 0.000000e+00 1927.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G052800 chr3A 28626230 28628889 2659 True 4913.000000 4913 100.000000 1 2660 1 chr3A.!!$R1 2659
1 TraesCS3A01G052800 chr3A 28735359 28738038 2679 True 2367.200000 4665 99.390500 1 2660 2 chr3A.!!$R3 2659
2 TraesCS3A01G052800 chr3A 28669746 28672429 2683 True 2355.200000 4641 99.295000 1 2660 2 chr3A.!!$R2 2659
3 TraesCS3A01G052800 chr3B 34148996 34151482 2486 True 3642.000000 3642 93.130000 48 2530 1 chr3B.!!$R1 2482
4 TraesCS3A01G052800 chr3B 34194712 34196389 1677 True 2388.000000 2388 92.335000 48 1729 1 chr3B.!!$R2 1681
5 TraesCS3A01G052800 chr3B 34008549 34011226 2677 True 1181.333333 2311 90.947333 48 2624 3 chr3B.!!$R4 2576
6 TraesCS3A01G052800 chr3B 34202900 34203513 613 True 920.000000 920 93.821000 1880 2489 1 chr3B.!!$R3 609
7 TraesCS3A01G052800 chr3B 34053548 34055241 1693 True 828.000000 1138 88.259000 910 2599 2 chr3B.!!$R5 1689
8 TraesCS3A01G052800 chrUn 366589742 366591618 1876 True 2852.000000 2852 94.143000 618 2489 1 chrUn.!!$R1 1871
9 TraesCS3A01G052800 chrUn 419983405 419984656 1251 False 1927.000000 1927 94.493000 1242 2489 1 chrUn.!!$F1 1247

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
895 896 0.390472 GGAGGCAGTTCAGGAACGAG 60.39 60.0 6.52 5.19 45.5 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1955 2080 1.762957 CGTATGTGGGATTCTGGGACT 59.237 52.381 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 2.562912 GTCGCCGACTACGTCCAA 59.437 61.111 10.56 0.00 37.88 3.53
874 875 1.138247 GGACCGCGTGTACGAGATT 59.862 57.895 8.82 0.00 41.67 2.40
895 896 0.390472 GGAGGCAGTTCAGGAACGAG 60.390 60.000 6.52 5.19 45.50 4.18
926 927 3.047877 CGCACAACCCCGAGTTCC 61.048 66.667 0.00 0.00 36.18 3.62
927 928 2.112297 GCACAACCCCGAGTTCCA 59.888 61.111 0.00 0.00 36.18 3.53
1225 1228 1.632046 CGACATTACGTGCCCGCTTT 61.632 55.000 0.00 0.00 37.70 3.51
1357 1360 1.837051 TCACACAGGGACGAAGCCT 60.837 57.895 0.00 0.00 0.00 4.58
1955 2080 8.016654 TTTCTTCTGAAAAAGAGGACAACTCCA 61.017 37.037 0.00 0.00 40.50 3.86
2621 2846 6.353323 TCCTTTTGTCTGACTAAATGACACA 58.647 36.000 15.71 0.00 39.95 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 3.339093 GCCAGGCCCCTGTACCTT 61.339 66.667 12.98 0.00 42.15 3.50
447 448 2.027192 ACGAACTGTGCAGGGAATATGT 60.027 45.455 4.11 0.00 0.00 2.29
505 506 2.819550 CGCCGGTGCCTATTAGGT 59.180 61.111 11.38 0.00 37.80 3.08
701 702 0.105913 TCCACCTCCAAAAACCCACC 60.106 55.000 0.00 0.00 0.00 4.61
775 776 0.462937 TGTTCAGGTCGTTGTGGTGG 60.463 55.000 0.00 0.00 0.00 4.61
819 820 2.028130 GCTGCTTCAGGTAGAGCTCTA 58.972 52.381 19.72 19.72 31.21 2.43
874 875 1.761174 GTTCCTGAACTGCCTCCCA 59.239 57.895 2.80 0.00 38.25 4.37
926 927 1.390123 CCATGTAGAACTCGCACGTTG 59.610 52.381 0.00 0.00 0.00 4.10
927 928 1.710013 CCATGTAGAACTCGCACGTT 58.290 50.000 0.00 0.00 0.00 3.99
1225 1228 4.934942 CCGTGCCGTCGTGTGTGA 62.935 66.667 0.00 0.00 0.00 3.58
1357 1360 0.397941 CTTTCAGTCAGTCCAGGCCA 59.602 55.000 5.01 0.00 0.00 5.36
1829 1952 3.084039 ACAATGGCAGTTACTGTCCATG 58.916 45.455 28.33 24.20 42.72 3.66
1955 2080 1.762957 CGTATGTGGGATTCTGGGACT 59.237 52.381 0.00 0.00 0.00 3.85
2621 2846 6.358974 AGCAAAAACCCAATTTATGCTACT 57.641 33.333 0.00 0.00 36.16 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.