Multiple sequence alignment - TraesCS3A01G019100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G019100 chr3A 100.000 3095 0 0 1 3095 11705903 11702809 0.000000e+00 5716
1 TraesCS3A01G019100 chr3A 99.258 3098 17 3 1 3095 11678457 11675363 0.000000e+00 5589
2 TraesCS3A01G019100 chr3A 100.000 1354 0 0 1 1354 11680521 11679168 0.000000e+00 2501
3 TraesCS3A01G019100 chr3D 87.367 1781 133 51 45 1766 9542450 9544197 0.000000e+00 1958
4 TraesCS3A01G019100 chr3D 88.157 1655 135 25 2 1620 5177381 5175752 0.000000e+00 1914
5 TraesCS3A01G019100 chr3D 90.882 1020 81 9 2078 3095 5175279 5174270 0.000000e+00 1358
6 TraesCS3A01G019100 chr3D 90.500 1021 84 10 2078 3095 9544500 9545510 0.000000e+00 1336
7 TraesCS3A01G019100 chr3D 89.377 273 29 0 1765 2037 9544229 9544501 8.220000e-91 344
8 TraesCS3A01G019100 chr3D 89.591 269 26 1 1769 2037 5175544 5175278 1.060000e-89 340
9 TraesCS3A01G019100 chr3D 93.711 159 10 0 1608 1766 5175738 5175580 3.990000e-59 239
10 TraesCS3A01G019100 chr3B 88.943 1239 88 19 553 1766 13731498 13732712 0.000000e+00 1483
11 TraesCS3A01G019100 chr3B 89.571 978 78 17 2131 3095 13733049 13734015 0.000000e+00 1219
12 TraesCS3A01G019100 chr3B 86.316 380 42 6 109 482 13729382 13729757 3.720000e-109 405
13 TraesCS3A01G019100 chr3B 87.500 248 25 3 1769 2016 13732748 13732989 6.530000e-72 281
14 TraesCS3A01G019100 chr4B 82.461 382 50 8 1642 2017 598602527 598602157 4.980000e-83 318
15 TraesCS3A01G019100 chr4B 76.720 567 84 23 986 1510 598913918 598913358 3.930000e-69 272
16 TraesCS3A01G019100 chr4B 76.167 621 89 23 938 1510 599170559 599169950 3.930000e-69 272
17 TraesCS3A01G019100 chr4B 86.555 238 26 3 1783 2017 598913092 598912858 1.100000e-64 257
18 TraesCS3A01G019100 chr4B 75.402 622 85 41 927 1515 598459222 598458636 3.990000e-59 239
19 TraesCS3A01G019100 chr4B 84.874 238 30 2 1783 2017 599169687 599169453 5.160000e-58 235
20 TraesCS3A01G019100 chr4B 81.765 170 26 2 1597 1766 598458575 598458411 1.500000e-28 137
21 TraesCS3A01G019100 chr4A 79.812 426 51 21 1625 2017 681653853 681654276 8.450000e-71 278
22 TraesCS3A01G019100 chr4A 74.884 645 96 34 927 1515 681593011 681593645 1.860000e-57 233
23 TraesCS3A01G019100 chr4D 73.927 932 134 63 654 1510 474701621 474700724 1.090000e-69 274
24 TraesCS3A01G019100 chr4D 87.097 124 16 0 1641 1764 474602516 474602393 1.160000e-29 141


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G019100 chr3A 11702809 11705903 3094 True 5716.000000 5716 100.000000 1 3095 1 chr3A.!!$R1 3094
1 TraesCS3A01G019100 chr3A 11675363 11680521 5158 True 4045.000000 5589 99.629000 1 3095 2 chr3A.!!$R2 3094
2 TraesCS3A01G019100 chr3D 9542450 9545510 3060 False 1212.666667 1958 89.081333 45 3095 3 chr3D.!!$F1 3050
3 TraesCS3A01G019100 chr3D 5174270 5177381 3111 True 962.750000 1914 90.585250 2 3095 4 chr3D.!!$R1 3093
4 TraesCS3A01G019100 chr3B 13729382 13734015 4633 False 847.000000 1483 88.082500 109 3095 4 chr3B.!!$F1 2986
5 TraesCS3A01G019100 chr4B 598912858 598913918 1060 True 264.500000 272 81.637500 986 2017 2 chr4B.!!$R3 1031
6 TraesCS3A01G019100 chr4B 599169453 599170559 1106 True 253.500000 272 80.520500 938 2017 2 chr4B.!!$R4 1079
7 TraesCS3A01G019100 chr4A 681593011 681593645 634 False 233.000000 233 74.884000 927 1515 1 chr4A.!!$F1 588
8 TraesCS3A01G019100 chr4D 474700724 474701621 897 True 274.000000 274 73.927000 654 1510 1 chr4D.!!$R2 856

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1494 5349 2.068821 GCTCTCTGCCCTCATCCCA 61.069 63.158 0.0 0.0 35.15 4.37 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2377 6318 1.376609 CTAATGTTCGCTGGGGTGGC 61.377 60.0 0.0 0.0 0.0 5.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1494 5349 2.068821 GCTCTCTGCCCTCATCCCA 61.069 63.158 0.00 0.00 35.15 4.37
2076 6013 2.539274 TGGTTGTAAAACTACGACACGC 59.461 45.455 0.00 0.00 36.34 5.34
2184 6122 4.825634 ACCTCACAATGGCATGATTGATAG 59.174 41.667 12.68 9.13 36.89 2.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1729 5630 2.659897 GACGCTCCTATGGCTGCG 60.660 66.667 16.98 16.98 45.20 5.18
2076 6013 4.263506 ACATCCTACCCTCTTTTCAAGGTG 60.264 45.833 0.00 0.00 33.70 4.00
2184 6122 6.127479 TGGAGTTTTTGCATGATTGTATACCC 60.127 38.462 0.00 0.00 0.00 3.69
2377 6318 1.376609 CTAATGTTCGCTGGGGTGGC 61.377 60.000 0.00 0.00 0.00 5.01
2946 6895 3.775202 ACCTCTGATCGAAAGTTCATCG 58.225 45.455 0.00 0.00 38.95 3.84
2947 6896 4.748892 TGACCTCTGATCGAAAGTTCATC 58.251 43.478 0.00 0.00 38.95 2.92
2948 6897 4.808414 TGACCTCTGATCGAAAGTTCAT 57.192 40.909 0.00 0.00 38.95 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.