Multiple sequence alignment - TraesCS3A01G018400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G018400 chr3A 100.000 4783 0 0 1 4783 11459617 11464399 0.000000e+00 8833
1 TraesCS3A01G018400 chr3A 98.500 2734 13 2 1 2708 40447791 40445060 0.000000e+00 4796
2 TraesCS3A01G018400 chr3A 99.400 1501 8 1 3271 4771 40445060 40443561 0.000000e+00 2721
3 TraesCS3A01G018400 chr3A 89.205 1232 112 15 962 2184 695899438 695898219 0.000000e+00 1519
4 TraesCS3A01G018400 chr5A 99.057 4774 21 2 1 4774 687743285 687738536 0.000000e+00 8545
5 TraesCS3A01G018400 chr5A 98.931 3834 18 1 938 4771 687733431 687737241 0.000000e+00 6831
6 TraesCS3A01G018400 chr5A 99.115 678 5 1 1 678 687732680 687733356 0.000000e+00 1218
7 TraesCS3A01G018400 chr5B 93.164 3511 148 33 989 4456 147199513 147202974 0.000000e+00 5070
8 TraesCS3A01G018400 chr5B 91.040 2221 149 27 2192 4379 13749321 13747118 0.000000e+00 2953
9 TraesCS3A01G018400 chr5B 96.442 1602 31 2 3170 4771 534681639 534680064 0.000000e+00 2619
10 TraesCS3A01G018400 chr5B 98.239 284 5 0 62 345 534682628 534682345 9.240000e-137 497
11 TraesCS3A01G018400 chr3B 98.280 2384 18 1 2388 4771 793277378 793279738 0.000000e+00 4154
12 TraesCS3A01G018400 chr3B 98.009 1909 10 2 1 1883 793275472 793277378 0.000000e+00 3290
13 TraesCS3A01G018400 chr3B 94.180 945 39 4 1 939 799580882 799581816 0.000000e+00 1426
14 TraesCS3A01G018400 chr2B 99.582 1912 8 0 2860 4771 56907339 56905428 0.000000e+00 3487
15 TraesCS3A01G018400 chr6B 89.354 2414 158 46 2004 4379 12895411 12897763 0.000000e+00 2942
16 TraesCS3A01G018400 chr6B 94.146 1230 70 2 956 2184 12894029 12895257 0.000000e+00 1871
17 TraesCS3A01G018400 chr7A 92.487 2063 121 16 2011 4055 12324664 12326710 0.000000e+00 2920
18 TraesCS3A01G018400 chr7A 91.953 2063 124 19 2011 4055 12267587 12269625 0.000000e+00 2852
19 TraesCS3A01G018400 chr7A 92.944 1233 77 7 956 2184 12323506 12324732 0.000000e+00 1786
20 TraesCS3A01G018400 chr7A 91.714 1231 90 6 956 2184 12266435 12267655 0.000000e+00 1698
21 TraesCS3A01G018400 chrUn 100.000 1475 0 0 1 1475 371199241 371197767 0.000000e+00 2724
22 TraesCS3A01G018400 chrUn 95.179 643 29 2 297 939 91408114 91408754 0.000000e+00 1014
23 TraesCS3A01G018400 chr6A 95.285 1230 56 2 956 2184 7125345 7126573 0.000000e+00 1949
24 TraesCS3A01G018400 chr6A 89.700 1000 68 16 2002 2996 90289451 90290420 0.000000e+00 1243
25 TraesCS3A01G018400 chr7B 94.449 1225 65 2 956 2179 727687828 727686606 0.000000e+00 1882
26 TraesCS3A01G018400 chr4B 98.647 813 8 2 1 812 631189906 631190716 0.000000e+00 1437
27 TraesCS3A01G018400 chr4A 99.337 754 4 1 1 754 646322373 646323125 0.000000e+00 1363
28 TraesCS3A01G018400 chr4A 99.447 723 4 0 4049 4771 646323123 646323845 0.000000e+00 1314
29 TraesCS3A01G018400 chr4A 91.742 666 28 13 6 663 708296553 708295907 0.000000e+00 900
30 TraesCS3A01G018400 chr4A 97.255 510 13 1 4262 4771 662109740 662110248 0.000000e+00 863


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G018400 chr3A 11459617 11464399 4782 False 8833.0 8833 100.0000 1 4783 1 chr3A.!!$F1 4782
1 TraesCS3A01G018400 chr3A 40443561 40447791 4230 True 3758.5 4796 98.9500 1 4771 2 chr3A.!!$R2 4770
2 TraesCS3A01G018400 chr3A 695898219 695899438 1219 True 1519.0 1519 89.2050 962 2184 1 chr3A.!!$R1 1222
3 TraesCS3A01G018400 chr5A 687738536 687743285 4749 True 8545.0 8545 99.0570 1 4774 1 chr5A.!!$R1 4773
4 TraesCS3A01G018400 chr5A 687732680 687737241 4561 False 4024.5 6831 99.0230 1 4771 2 chr5A.!!$F1 4770
5 TraesCS3A01G018400 chr5B 147199513 147202974 3461 False 5070.0 5070 93.1640 989 4456 1 chr5B.!!$F1 3467
6 TraesCS3A01G018400 chr5B 13747118 13749321 2203 True 2953.0 2953 91.0400 2192 4379 1 chr5B.!!$R1 2187
7 TraesCS3A01G018400 chr5B 534680064 534682628 2564 True 1558.0 2619 97.3405 62 4771 2 chr5B.!!$R2 4709
8 TraesCS3A01G018400 chr3B 793275472 793279738 4266 False 3722.0 4154 98.1445 1 4771 2 chr3B.!!$F2 4770
9 TraesCS3A01G018400 chr3B 799580882 799581816 934 False 1426.0 1426 94.1800 1 939 1 chr3B.!!$F1 938
10 TraesCS3A01G018400 chr2B 56905428 56907339 1911 True 3487.0 3487 99.5820 2860 4771 1 chr2B.!!$R1 1911
11 TraesCS3A01G018400 chr6B 12894029 12897763 3734 False 2406.5 2942 91.7500 956 4379 2 chr6B.!!$F1 3423
12 TraesCS3A01G018400 chr7A 12323506 12326710 3204 False 2353.0 2920 92.7155 956 4055 2 chr7A.!!$F2 3099
13 TraesCS3A01G018400 chr7A 12266435 12269625 3190 False 2275.0 2852 91.8335 956 4055 2 chr7A.!!$F1 3099
14 TraesCS3A01G018400 chrUn 371197767 371199241 1474 True 2724.0 2724 100.0000 1 1475 1 chrUn.!!$R1 1474
15 TraesCS3A01G018400 chrUn 91408114 91408754 640 False 1014.0 1014 95.1790 297 939 1 chrUn.!!$F1 642
16 TraesCS3A01G018400 chr6A 7125345 7126573 1228 False 1949.0 1949 95.2850 956 2184 1 chr6A.!!$F1 1228
17 TraesCS3A01G018400 chr6A 90289451 90290420 969 False 1243.0 1243 89.7000 2002 2996 1 chr6A.!!$F2 994
18 TraesCS3A01G018400 chr7B 727686606 727687828 1222 True 1882.0 1882 94.4490 956 2179 1 chr7B.!!$R1 1223
19 TraesCS3A01G018400 chr4B 631189906 631190716 810 False 1437.0 1437 98.6470 1 812 1 chr4B.!!$F1 811
20 TraesCS3A01G018400 chr4A 646322373 646323845 1472 False 1338.5 1363 99.3920 1 4771 2 chr4A.!!$F2 4770
21 TraesCS3A01G018400 chr4A 708295907 708296553 646 True 900.0 900 91.7420 6 663 1 chr4A.!!$R1 657
22 TraesCS3A01G018400 chr4A 662109740 662110248 508 False 863.0 863 97.2550 4262 4771 1 chr4A.!!$F1 509

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2165 2551 5.049198 GCTATATTTGCTCACATGCTTGCTA 60.049 40.0 0.0 0.0 0.0 3.49 F
2486 2977 0.034670 AAGCCTTGACCTCTCATGCC 60.035 55.0 0.0 0.0 0.0 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3177 3710 6.209788 CCTCTAAGTAGTTCCTCAACTCACTT 59.790 42.308 11.23 11.23 42.27 3.16 R
4392 4965 6.558009 CAAAGTGTATGCTAGAACATGCAAT 58.442 36.000 0.00 0.00 43.00 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2165 2551 5.049198 GCTATATTTGCTCACATGCTTGCTA 60.049 40.000 0.00 0.00 0.00 3.49
2449 2940 9.717942 GAGTTCAACCTATAAGATGATTAGCAT 57.282 33.333 0.00 0.00 40.77 3.79
2486 2977 0.034670 AAGCCTTGACCTCTCATGCC 60.035 55.000 0.00 0.00 0.00 4.40
3177 3710 6.566942 CGTCCCGTTCAACAAGAATATCAAAA 60.567 38.462 0.00 0.00 38.76 2.44
4392 4965 7.013750 CAGATGCCTAAACTGATGACTAGTCTA 59.986 40.741 23.01 10.48 34.07 2.59
4771 5355 3.388841 GACCGTGTCCACCCTGAT 58.611 61.111 0.00 0.00 0.00 2.90
4774 5358 0.543410 ACCGTGTCCACCCTGATGTA 60.543 55.000 0.00 0.00 0.00 2.29
4775 5359 0.108329 CCGTGTCCACCCTGATGTAC 60.108 60.000 0.00 0.00 0.00 2.90
4776 5360 0.606096 CGTGTCCACCCTGATGTACA 59.394 55.000 0.00 0.00 0.00 2.90
4777 5361 1.207089 CGTGTCCACCCTGATGTACAT 59.793 52.381 8.43 8.43 0.00 2.29
4778 5362 2.632377 GTGTCCACCCTGATGTACATG 58.368 52.381 14.43 0.79 0.00 3.21
4779 5363 1.065491 TGTCCACCCTGATGTACATGC 60.065 52.381 14.43 5.76 0.00 4.06
4780 5364 0.546122 TCCACCCTGATGTACATGCC 59.454 55.000 14.43 0.00 0.00 4.40
4781 5365 0.255604 CCACCCTGATGTACATGCCA 59.744 55.000 14.43 5.04 0.00 4.92
4782 5366 1.133699 CCACCCTGATGTACATGCCAT 60.134 52.381 14.43 0.00 0.00 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1595 1731 5.919141 GGATTCATGCACTTCATTAGAATGC 59.081 40.000 0.00 0.00 38.06 3.56
2449 2940 3.211045 GCTTCCTTATAATCACGGGCAA 58.789 45.455 0.00 0.00 0.00 4.52
2486 2977 1.202290 GCATAGTTGGCATTGGAACCG 60.202 52.381 0.00 0.00 0.00 4.44
3177 3710 6.209788 CCTCTAAGTAGTTCCTCAACTCACTT 59.790 42.308 11.23 11.23 42.27 3.16
4392 4965 6.558009 CAAAGTGTATGCTAGAACATGCAAT 58.442 36.000 0.00 0.00 43.00 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.