Multiple sequence alignment - TraesCS3A01G005200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G005200 chr3A 100.000 2371 0 0 1 2371 5486750 5489120 0 4379
1 TraesCS3A01G005200 chr3A 99.156 2371 20 0 1 2371 4484518 4486888 0 4268
2 TraesCS3A01G005200 chr3A 99.156 2371 19 1 1 2371 4490915 4493284 0 4266
3 TraesCS3A01G005200 chr3A 99.114 2371 21 0 1 2371 3434237 3436607 0 4263
4 TraesCS3A01G005200 chr3A 99.114 2370 21 0 2 2371 2914401 2916770 0 4261
5 TraesCS3A01G005200 chr3A 99.114 2371 20 1 1 2371 4478124 4480493 0 4261
6 TraesCS3A01G005200 chr3A 99.072 2371 20 2 1 2371 2434786 2437154 0 4255
7 TraesCS3A01G005200 chr3A 98.356 2372 36 3 1 2371 2417995 2420364 0 4161
8 TraesCS3A01G005200 chr3A 98.313 2371 40 0 1 2371 4125675 4128045 0 4157
9 TraesCS3A01G005200 chr3A 98.314 2372 38 2 1 2371 4461302 4463672 0 4157


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G005200 chr3A 5486750 5489120 2370 False 4379 4379 100.000 1 2371 1 chr3A.!!$F10 2370
1 TraesCS3A01G005200 chr3A 4484518 4486888 2370 False 4268 4268 99.156 1 2371 1 chr3A.!!$F8 2370
2 TraesCS3A01G005200 chr3A 4490915 4493284 2369 False 4266 4266 99.156 1 2371 1 chr3A.!!$F9 2370
3 TraesCS3A01G005200 chr3A 3434237 3436607 2370 False 4263 4263 99.114 1 2371 1 chr3A.!!$F4 2370
4 TraesCS3A01G005200 chr3A 2914401 2916770 2369 False 4261 4261 99.114 2 2371 1 chr3A.!!$F3 2369
5 TraesCS3A01G005200 chr3A 4478124 4480493 2369 False 4261 4261 99.114 1 2371 1 chr3A.!!$F7 2370
6 TraesCS3A01G005200 chr3A 2434786 2437154 2368 False 4255 4255 99.072 1 2371 1 chr3A.!!$F2 2370
7 TraesCS3A01G005200 chr3A 2417995 2420364 2369 False 4161 4161 98.356 1 2371 1 chr3A.!!$F1 2370
8 TraesCS3A01G005200 chr3A 4125675 4128045 2370 False 4157 4157 98.313 1 2371 1 chr3A.!!$F5 2370
9 TraesCS3A01G005200 chr3A 4461302 4463672 2370 False 4157 4157 98.314 1 2371 1 chr3A.!!$F6 2370

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
858 860 1.067985 GCTTCCTTGCTTTCCTCTTGC 60.068 52.381 0.0 0.0 0.0 4.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2141 2145 0.451783 GACGCGGATGCTTGGATTTT 59.548 50.0 12.47 0.0 39.65 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
858 860 1.067985 GCTTCCTTGCTTTCCTCTTGC 60.068 52.381 0.0 0.0 0.00 4.01
899 901 8.834004 ATTTATACTATCTATAGGGCACGGAA 57.166 34.615 0.0 0.0 34.69 4.30
2011 2015 6.544928 AGATTCAACCCAACAAAAAGAAGT 57.455 33.333 0.0 0.0 0.00 3.01
2141 2145 3.324846 CCGTCCAATGAATGATAGGAGGA 59.675 47.826 0.0 0.0 36.61 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1421 1423 5.639931 TGACGTCAATCATTAAAACCGATGA 59.360 36.0 17.62 0.0 36.77 2.92
2141 2145 0.451783 GACGCGGATGCTTGGATTTT 59.548 50.0 12.47 0.0 39.65 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.