Multiple sequence alignment - TraesCS3A01G004900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G004900 chr3A 100.000 2371 0 0 1 2371 4461302 4463672 0 4379
1 TraesCS3A01G004900 chr3A 98.988 2371 23 1 1 2371 3409936 3412305 0 4244
2 TraesCS3A01G004900 chr3A 98.819 2371 28 0 1 2371 5470069 5472439 0 4224
3 TraesCS3A01G004900 chr3A 98.524 2371 33 2 1 2371 2897579 2899947 0 4183
4 TraesCS3A01G004900 chr3A 98.314 2372 38 2 1 2371 5486750 5489120 0 4157
5 TraesCS3A01G004900 chr3A 98.313 2371 38 2 2 2371 2914401 2916770 0 4156
6 TraesCS3A01G004900 chr3A 98.272 2372 39 2 1 2371 3434237 3436607 0 4152
7 TraesCS3A01G004900 chr3A 98.272 2372 39 2 1 2371 4484518 4486888 0 4152
8 TraesCS3A01G004900 chr3A 98.229 2372 38 4 1 2371 2434786 2437154 0 4145
9 TraesCS3A01G004900 chr3A 98.229 2372 39 3 1 2371 4478124 4480493 0 4145


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G004900 chr3A 4461302 4463672 2370 False 4379 4379 100.000 1 2371 1 chr3A.!!$F6 2370
1 TraesCS3A01G004900 chr3A 3409936 3412305 2369 False 4244 4244 98.988 1 2371 1 chr3A.!!$F4 2370
2 TraesCS3A01G004900 chr3A 5470069 5472439 2370 False 4224 4224 98.819 1 2371 1 chr3A.!!$F9 2370
3 TraesCS3A01G004900 chr3A 2897579 2899947 2368 False 4183 4183 98.524 1 2371 1 chr3A.!!$F2 2370
4 TraesCS3A01G004900 chr3A 5486750 5489120 2370 False 4157 4157 98.314 1 2371 1 chr3A.!!$F10 2370
5 TraesCS3A01G004900 chr3A 2914401 2916770 2369 False 4156 4156 98.313 2 2371 1 chr3A.!!$F3 2369
6 TraesCS3A01G004900 chr3A 3434237 3436607 2370 False 4152 4152 98.272 1 2371 1 chr3A.!!$F5 2370
7 TraesCS3A01G004900 chr3A 4484518 4486888 2370 False 4152 4152 98.272 1 2371 1 chr3A.!!$F8 2370
8 TraesCS3A01G004900 chr3A 2434786 2437154 2368 False 4145 4145 98.229 1 2371 1 chr3A.!!$F1 2370
9 TraesCS3A01G004900 chr3A 4478124 4480493 2369 False 4145 4145 98.229 1 2371 1 chr3A.!!$F7 2370

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
828 829 6.681729 AGTTCACTTAGTTGTATTCCTCCA 57.318 37.5 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2124 2126 6.138263 TGGATTTGCCTCCTATCATTCATTT 58.862 36.0 0.0 0.0 36.2 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 8.031277 GTCAATGCCATCTGAAGAAGTTAAAAT 58.969 33.333 0.00 0.0 0.00 1.82
828 829 6.681729 AGTTCACTTAGTTGTATTCCTCCA 57.318 37.500 0.00 0.0 0.00 3.86
2124 2126 1.894466 TCCGTTGAATTACCTCCGTCA 59.106 47.619 0.00 0.0 0.00 4.35
2186 2188 7.322664 CAATGGATTAACTAATTGGTTGCACT 58.677 34.615 16.66 0.0 0.00 4.40
2207 2209 0.174162 GATTGTGCCACCTTGCATCC 59.826 55.000 0.00 0.0 44.30 3.51
2213 2215 1.006998 TGCCACCTTGCATCCCTAAAT 59.993 47.619 0.00 0.0 36.04 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
788 789 1.808411 ACTAAACCTGGCACACATCG 58.192 50.000 0.0 0.0 0.00 3.84
828 829 5.991606 GGAAAGCAAGGAAGCAAAATTAACT 59.008 36.000 0.0 0.0 36.85 2.24
1598 1600 5.094812 GCGAGTGAAATATCAAATGTTGCA 58.905 37.500 0.0 0.0 37.30 4.08
2124 2126 6.138263 TGGATTTGCCTCCTATCATTCATTT 58.862 36.000 0.0 0.0 36.20 2.32
2207 2209 7.032580 CGACTGGCAAGATAGAGATATTTAGG 58.967 42.308 0.0 0.0 0.00 2.69
2213 2215 6.238648 TCATACGACTGGCAAGATAGAGATA 58.761 40.000 0.0 0.0 0.00 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.