Multiple sequence alignment - TraesCS3A01G004600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G004600 chr3A 100.000 2970 0 0 1 2970 3409650 3412619 0 5485
1 TraesCS3A01G004600 chr3A 98.788 2971 35 1 1 2970 4461016 4463986 0 5286
2 TraesCS3A01G004600 chr3A 98.519 2971 43 1 1 2970 5469783 5472753 0 5241
3 TraesCS3A01G004600 chr3A 98.452 2971 43 3 1 2970 2897293 2900261 0 5228
4 TraesCS3A01G004600 chr3A 97.915 2974 56 5 1 2970 4490629 4493600 0 5144
5 TraesCS3A01G004600 chr3A 97.882 2974 57 5 1 2970 4477838 4480809 0 5138
6 TraesCS3A01G004600 chr3A 97.882 2974 58 4 1 2970 5486464 5489436 0 5138
7 TraesCS3A01G004600 chr3A 97.880 2972 59 4 1 2970 2417709 2420678 0 5136
8 TraesCS3A01G004600 chr3A 97.848 2974 59 4 1 2970 4484232 4487204 0 5132
9 TraesCS3A01G004600 chr3A 97.848 2974 57 6 1 2970 2434500 2437470 0 5131


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G004600 chr3A 3409650 3412619 2969 False 5485 5485 100.000000 1 2970 1 chr3A.!!$F4 2969
1 TraesCS3A01G004600 chr3A 4461016 4463986 2970 False 5286 5286 98.788000 1 2970 1 chr3A.!!$F5 2969
2 TraesCS3A01G004600 chr3A 5469783 5472753 2970 False 5241 5241 98.519000 1 2970 1 chr3A.!!$F6 2969
3 TraesCS3A01G004600 chr3A 2897293 2900261 2968 False 5228 5228 98.452000 1 2970 1 chr3A.!!$F3 2969
4 TraesCS3A01G004600 chr3A 4477838 4493600 15762 False 5138 5144 97.881667 1 2970 3 chr3A.!!$F8 2969
5 TraesCS3A01G004600 chr3A 5486464 5489436 2972 False 5138 5138 97.882000 1 2970 1 chr3A.!!$F7 2969
6 TraesCS3A01G004600 chr3A 2417709 2420678 2969 False 5136 5136 97.880000 1 2970 1 chr3A.!!$F1 2969
7 TraesCS3A01G004600 chr3A 2434500 2437470 2970 False 5131 5131 97.848000 1 2970 1 chr3A.!!$F2 2969

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
40 41 1.730501 ATGCACACGTTCCATCTGAG 58.269 50.000 0.00 0.00 0.00 3.35 F
751 754 2.277084 CTAATTTTCCAGACGTCCCCG 58.723 52.381 13.01 0.63 40.83 5.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1067 1070 3.439857 ACCTGGCACACATCTTACAAT 57.560 42.857 0.0 0.0 0.0 2.71 R
2013 8412 6.657541 GGAACTTATGTGTGATTCTTTACCCA 59.342 38.462 0.0 0.0 0.0 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 1.730501 ATGCACACGTTCCATCTGAG 58.269 50.000 0.00 0.00 0.00 3.35
94 95 6.507023 GCAAATGGTATATGGGAAGAAACAG 58.493 40.000 0.00 0.00 0.00 3.16
745 748 4.575885 TGAACCTCCTAATTTTCCAGACG 58.424 43.478 0.00 0.00 0.00 4.18
751 754 2.277084 CTAATTTTCCAGACGTCCCCG 58.723 52.381 13.01 0.63 40.83 5.73
812 815 9.944376 AGTATTGAAAACATGAACTAGCTCTAA 57.056 29.630 0.00 0.00 0.00 2.10
2785 15582 5.801947 GTCCTTGTAAGCGTAAACTATTCGA 59.198 40.000 0.00 0.00 0.00 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 5.399858 ACTAGTCATCACACACGTTACATC 58.600 41.667 0.00 0.00 0.00 3.06
405 408 4.440525 GCCCATCAACGACATGAATCATTT 60.441 41.667 0.00 0.00 32.06 2.32
745 748 0.178984 TTTTTGGAGTTCCCGGGGAC 60.179 55.000 26.01 26.01 37.93 4.46
751 754 6.041637 AGTGAAAATAGGTTTTTGGAGTTCCC 59.958 38.462 0.00 0.00 37.65 3.97
1067 1070 3.439857 ACCTGGCACACATCTTACAAT 57.560 42.857 0.00 0.00 0.00 2.71
1464 1467 4.202367 GGTAGATGAAACCTCACCTATGGG 60.202 50.000 0.00 0.00 29.96 4.00
2013 8412 6.657541 GGAACTTATGTGTGATTCTTTACCCA 59.342 38.462 0.00 0.00 0.00 4.51
2785 15582 3.576078 TTGACACTGTCTTCCCATTGT 57.424 42.857 10.54 0.00 33.15 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.