Multiple sequence alignment - TraesCS3A01G004500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G004500 chr3A 100.000 3340 0 0 1 3340 2913745 2917084 0 6168
1 TraesCS3A01G004500 chr3A 99.072 3341 28 3 1 3340 2434131 2437469 0 5995
2 TraesCS3A01G004500 chr3A 98.922 3341 35 1 1 3340 5486095 5489435 0 5969
3 TraesCS3A01G004500 chr3A 98.893 3341 35 2 1 3340 4490260 4493599 0 5963
4 TraesCS3A01G004500 chr3A 98.862 3339 37 1 1 3338 3433582 3436920 0 5954
5 TraesCS3A01G004500 chr3A 98.833 3341 38 1 1 3340 4483863 4487203 0 5952
6 TraesCS3A01G004500 chr3A 98.888 3327 35 2 15 3340 4477483 4480808 0 5938
7 TraesCS3A01G004500 chr3A 98.205 3342 54 5 1 3340 2417340 2420677 0 5834
8 TraesCS3A01G004500 chr3A 98.175 3342 54 6 1 3340 2896924 2900260 0 5827
9 TraesCS3A01G004500 chr3A 98.025 3341 65 1 1 3340 4125020 4128360 0 5803


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G004500 chr3A 2913745 2917084 3339 False 6168 6168 100.000000 1 3340 1 chr3A.!!$F4 3339
1 TraesCS3A01G004500 chr3A 2434131 2437469 3338 False 5995 5995 99.072000 1 3340 1 chr3A.!!$F2 3339
2 TraesCS3A01G004500 chr3A 5486095 5489435 3340 False 5969 5969 98.922000 1 3340 1 chr3A.!!$F7 3339
3 TraesCS3A01G004500 chr3A 3433582 3436920 3338 False 5954 5954 98.862000 1 3338 1 chr3A.!!$F5 3337
4 TraesCS3A01G004500 chr3A 4477483 4493599 16116 False 5951 5963 98.871333 1 3340 3 chr3A.!!$F8 3339
5 TraesCS3A01G004500 chr3A 2417340 2420677 3337 False 5834 5834 98.205000 1 3340 1 chr3A.!!$F1 3339
6 TraesCS3A01G004500 chr3A 2896924 2900260 3336 False 5827 5827 98.175000 1 3340 1 chr3A.!!$F3 3339
7 TraesCS3A01G004500 chr3A 4125020 4128360 3340 False 5803 5803 98.025000 1 3340 1 chr3A.!!$F6 3339

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
655 656 6.705825 CACATGGTATCGGAAACATTATGAGA 59.294 38.462 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2411 8809 6.012113 TCATCCCACTTTGATCTGACAAAAT 58.988 36.0 0.0 0.0 38.9 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
269 270 9.480861 TGGTTACATCAAATCCCACAATTTATA 57.519 29.630 0.00 0.0 0.00 0.98
493 494 7.226441 AGATAGTTATGCCATCACAAGCAATA 58.774 34.615 0.00 0.0 43.36 1.90
655 656 6.705825 CACATGGTATCGGAAACATTATGAGA 59.294 38.462 0.00 0.0 0.00 3.27
1136 1138 0.958822 CCCCTGGAACTCCAAAAACG 59.041 55.000 0.00 0.0 46.97 3.60
1316 1318 4.379652 CCTTTTGTAGCCAATGTGCTTTT 58.620 39.130 1.85 0.0 42.75 2.27
2185 2188 8.902806 TCCAGACCATTGTATTCAAATTATGAC 58.097 33.333 0.00 0.0 37.92 3.06
2411 8809 9.391006 GGTAAAGAATCACACATAAGTTCCATA 57.609 33.333 0.00 0.0 0.00 2.74
2666 9064 7.439056 GCAAGATTCAATCCAACAAAAAGAAGA 59.561 33.333 0.00 0.0 0.00 2.87
2803 9201 3.743521 TGAATGATAGGAGGCAAATCCG 58.256 45.455 0.00 0.0 44.65 4.18
3144 15938 5.235831 GCGAAAACTAACTGTCCTTGTAAGT 59.764 40.000 0.00 0.0 0.00 2.24
3192 15986 3.754323 AGTGTCAAACAAAGGTTCGTTGA 59.246 39.130 1.04 0.0 35.82 3.18
3225 16019 3.747529 CGTAAAACGAGGGGCTTTTCTTA 59.252 43.478 0.00 0.0 46.05 2.10
3249 16043 0.905357 AGGCAGAAGTGAATAGCGGT 59.095 50.000 0.00 0.0 0.00 5.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
493 494 5.895636 TCACTGCCAATTCGTTTCATTAT 57.104 34.783 0.00 0.0 0.00 1.28
655 656 6.434028 ACATTGTAGTCTTAACAACATGGCAT 59.566 34.615 0.00 0.0 39.51 4.40
1316 1318 6.222038 AGCATCTAAACTAAGATTGACGGA 57.778 37.500 0.00 0.0 33.87 4.69
2411 8809 6.012113 TCATCCCACTTTGATCTGACAAAAT 58.988 36.000 0.00 0.0 38.90 1.82
2803 9201 2.537560 CCATTGGACGCGGATGCTC 61.538 63.158 12.47 0.0 39.65 4.26
3144 15938 4.223556 TCCCATTGCCGAATAGTTTACA 57.776 40.909 0.00 0.0 0.00 2.41
3225 16019 4.576463 CCGCTATTCACTTCTGCCTATTTT 59.424 41.667 0.00 0.0 0.00 1.82
3249 16043 0.183014 TGCAACTGGTCGGGGTTAAA 59.817 50.000 0.00 0.0 0.00 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.