Multiple sequence alignment - TraesCS3A01G004300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G004300 chr3A 100.000 2371 0 0 1 2371 2603526 2605896 0 4379
1 TraesCS3A01G004300 chr3A 99.325 2371 16 0 1 2371 4125675 4128045 0 4290
2 TraesCS3A01G004300 chr3A 99.030 2371 23 0 1 2371 3073095 3075465 0 4252
3 TraesCS3A01G004300 chr3A 99.030 2371 23 0 1 2371 5140174 5142544 0 4252
4 TraesCS3A01G004300 chr3A 98.777 2371 27 2 1 2371 4644992 4647360 0 4217
5 TraesCS3A01G004300 chr3A 98.609 2372 32 1 1 2371 2136155 2138526 0 4196
6 TraesCS3A01G004300 chr3A 98.567 2372 33 1 1 2371 3601204 3603575 0 4191
7 TraesCS3A01G004300 chr3A 98.186 2371 43 0 1 2371 4484518 4486888 0 4141
8 TraesCS3A01G004300 chr3A 98.186 2371 43 0 1 2371 5486750 5489120 0 4141
9 TraesCS3A01G004300 chr3A 98.186 2371 42 1 1 2371 4490915 4493284 0 4139


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G004300 chr3A 2603526 2605896 2370 False 4379 4379 100.000 1 2371 1 chr3A.!!$F2 2370
1 TraesCS3A01G004300 chr3A 4125675 4128045 2370 False 4290 4290 99.325 1 2371 1 chr3A.!!$F5 2370
2 TraesCS3A01G004300 chr3A 3073095 3075465 2370 False 4252 4252 99.030 1 2371 1 chr3A.!!$F3 2370
3 TraesCS3A01G004300 chr3A 5140174 5142544 2370 False 4252 4252 99.030 1 2371 1 chr3A.!!$F9 2370
4 TraesCS3A01G004300 chr3A 4644992 4647360 2368 False 4217 4217 98.777 1 2371 1 chr3A.!!$F8 2370
5 TraesCS3A01G004300 chr3A 2136155 2138526 2371 False 4196 4196 98.609 1 2371 1 chr3A.!!$F1 2370
6 TraesCS3A01G004300 chr3A 3601204 3603575 2371 False 4191 4191 98.567 1 2371 1 chr3A.!!$F4 2370
7 TraesCS3A01G004300 chr3A 4484518 4486888 2370 False 4141 4141 98.186 1 2371 1 chr3A.!!$F6 2370
8 TraesCS3A01G004300 chr3A 5486750 5489120 2370 False 4141 4141 98.186 1 2371 1 chr3A.!!$F10 2370
9 TraesCS3A01G004300 chr3A 4490915 4493284 2369 False 4139 4139 98.186 1 2371 1 chr3A.!!$F7 2370

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
488 491 6.183361 CCCTGGAACTCCAAAAACCTATTTTT 60.183 38.462 0.0 0.0 46.68 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1874 1877 1.414181 CCCGAGGTGATGTCTAGCATT 59.586 52.381 1.93 0.0 38.06 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
488 491 6.183361 CCCTGGAACTCCAAAAACCTATTTTT 60.183 38.462 0.00 0.0 46.68 1.94
1466 1469 5.398122 GTCAAACATGTTGTAACACCAATCG 59.602 40.000 12.82 0.0 42.51 3.34
1874 1877 2.752829 GCTTCAGGCAGCCCCATAAATA 60.753 50.000 8.22 0.0 41.35 1.40
2176 2179 3.623960 CCGCGTCCAATGGATTAACTAAA 59.376 43.478 4.81 0.0 32.73 1.85
2227 2230 6.545508 CATCTCTAGACATCTCTATCTTGCG 58.454 44.000 0.00 0.0 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
712 715 6.888088 TGAACTGAATCATTCCTCACATTGAT 59.112 34.615 0.00 0.0 0.00 2.57
1874 1877 1.414181 CCCGAGGTGATGTCTAGCATT 59.586 52.381 1.93 0.0 38.06 3.56
2227 2230 4.360563 CACATAACCACCTCATACGACTC 58.639 47.826 0.00 0.0 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.