Multiple sequence alignment - TraesCS3A01G004200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G004200 chr3A 100.000 2371 0 0 1 2371 2434784 2437154 0 4379
1 TraesCS3A01G004200 chr3A 99.157 2373 18 2 1 2371 4484516 4486888 0 4270
2 TraesCS3A01G004200 chr3A 99.157 2373 17 3 1 2371 4490913 4493284 0 4268
3 TraesCS3A01G004200 chr3A 99.115 2373 19 2 1 2371 2914398 2916770 0 4265
4 TraesCS3A01G004200 chr3A 99.115 2373 19 2 1 2371 3434235 3436607 0 4265
5 TraesCS3A01G004200 chr3A 99.115 2373 18 3 1 2371 4478122 4480493 0 4263
6 TraesCS3A01G004200 chr3A 99.073 2373 20 2 1 2371 5486748 5489120 0 4259
7 TraesCS3A01G004200 chr3A 98.567 2372 33 1 1 2371 2417993 2420364 0 4191
8 TraesCS3A01G004200 chr3A 98.355 2371 37 2 2 2371 2897578 2899947 0 4161
9 TraesCS3A01G004200 chr3A 98.230 2373 40 2 1 2371 4125673 4128045 0 4148


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G004200 chr3A 2434784 2437154 2370 False 4379 4379 100.000 1 2371 1 chr3A.!!$F2 2370
1 TraesCS3A01G004200 chr3A 4484516 4486888 2372 False 4270 4270 99.157 1 2371 1 chr3A.!!$F8 2370
2 TraesCS3A01G004200 chr3A 4490913 4493284 2371 False 4268 4268 99.157 1 2371 1 chr3A.!!$F9 2370
3 TraesCS3A01G004200 chr3A 2914398 2916770 2372 False 4265 4265 99.115 1 2371 1 chr3A.!!$F4 2370
4 TraesCS3A01G004200 chr3A 3434235 3436607 2372 False 4265 4265 99.115 1 2371 1 chr3A.!!$F5 2370
5 TraesCS3A01G004200 chr3A 4478122 4480493 2371 False 4263 4263 99.115 1 2371 1 chr3A.!!$F7 2370
6 TraesCS3A01G004200 chr3A 5486748 5489120 2372 False 4259 4259 99.073 1 2371 1 chr3A.!!$F10 2370
7 TraesCS3A01G004200 chr3A 2417993 2420364 2371 False 4191 4191 98.567 1 2371 1 chr3A.!!$F1 2370
8 TraesCS3A01G004200 chr3A 2897578 2899947 2369 False 4161 4161 98.355 2 2371 1 chr3A.!!$F3 2369
9 TraesCS3A01G004200 chr3A 4125673 4128045 2372 False 4148 4148 98.230 1 2371 1 chr3A.!!$F6 2370

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
992 996 2.496899 AAATCACCGACATTCTGCCT 57.503 45.0 0.0 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2345 2351 1.455849 CACAGGAGCCAGGAAACCA 59.544 57.895 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
846 850 5.838521 TCCTCTGGTTAATTTTGCTTCCTTT 59.161 36.000 0.00 0.0 0.0 3.11
992 996 2.496899 AAATCACCGACATTCTGCCT 57.503 45.000 0.00 0.0 0.0 4.75
1639 1645 4.020751 ACTCGCATGCATCATCCTAGTAAT 60.021 41.667 19.57 0.0 0.0 1.89
2028 2034 7.823745 AAAGAAGCTCAAAATAAGAGGTGAA 57.176 32.000 0.00 0.0 42.5 3.18
2345 2351 8.537016 TGCCAGTTGTAGTAGTATCAATAGTTT 58.463 33.333 0.00 0.0 0.0 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
846 850 2.028385 GTCGTAAGGCCAAGAGGAAAGA 60.028 50.000 5.01 0.0 36.29 2.52
992 996 2.711009 CTCCAGGCCTCCATGGTATAAA 59.289 50.000 12.58 0.0 37.84 1.40
1601 1607 5.397534 GCATGCGAGTGAAATATCAAATGTC 59.602 40.000 0.00 0.0 37.30 3.06
1986 1992 7.989170 AGCTTCTTTTTGTTGGATTGAATCTTT 59.011 29.630 5.03 0.0 0.00 2.52
2028 2034 7.786943 TCAAAGATCCTAGACATCTATGAGGTT 59.213 37.037 4.97 0.0 29.97 3.50
2345 2351 1.455849 CACAGGAGCCAGGAAACCA 59.544 57.895 0.00 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.