Multiple sequence alignment - TraesCS3A01G004100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G004100 chr3A 100.000 2371 0 0 1 2371 2417993 2420363 0 4379
1 TraesCS3A01G004100 chr3A 98.566 2371 33 1 1 2371 2434784 2437153 0 4189
2 TraesCS3A01G004100 chr3A 98.483 2373 33 3 1 2371 2914398 2916769 0 4180
3 TraesCS3A01G004100 chr3A 98.439 2370 36 1 2 2371 2897578 2899946 0 4170
4 TraesCS3A01G004100 chr3A 98.399 2373 35 3 1 2371 3434235 3436606 0 4169
5 TraesCS3A01G004100 chr3A 98.357 2373 36 3 1 2371 4484516 4486887 0 4163
6 TraesCS3A01G004100 chr3A 98.357 2373 35 4 1 2371 4490913 4493283 0 4163
7 TraesCS3A01G004100 chr3A 98.357 2373 36 3 1 2371 5486748 5489119 0 4163
8 TraesCS3A01G004100 chr3A 98.314 2373 36 4 1 2371 4478122 4480492 0 4157
9 TraesCS3A01G004100 chr3A 98.104 2373 42 3 1 2371 5470067 5472438 0 4130


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G004100 chr3A 2417993 2420363 2370 False 4379 4379 100.000 1 2371 1 chr3A.!!$F1 2370
1 TraesCS3A01G004100 chr3A 2434784 2437153 2369 False 4189 4189 98.566 1 2371 1 chr3A.!!$F2 2370
2 TraesCS3A01G004100 chr3A 2914398 2916769 2371 False 4180 4180 98.483 1 2371 1 chr3A.!!$F4 2370
3 TraesCS3A01G004100 chr3A 2897578 2899946 2368 False 4170 4170 98.439 2 2371 1 chr3A.!!$F3 2369
4 TraesCS3A01G004100 chr3A 3434235 3436606 2371 False 4169 4169 98.399 1 2371 1 chr3A.!!$F5 2370
5 TraesCS3A01G004100 chr3A 4484516 4486887 2371 False 4163 4163 98.357 1 2371 1 chr3A.!!$F7 2370
6 TraesCS3A01G004100 chr3A 4490913 4493283 2370 False 4163 4163 98.357 1 2371 1 chr3A.!!$F8 2370
7 TraesCS3A01G004100 chr3A 5486748 5489119 2371 False 4163 4163 98.357 1 2371 1 chr3A.!!$F10 2370
8 TraesCS3A01G004100 chr3A 4478122 4480492 2370 False 4157 4157 98.314 1 2371 1 chr3A.!!$F6 2370
9 TraesCS3A01G004100 chr3A 5470067 5472438 2371 False 4130 4130 98.104 1 2371 1 chr3A.!!$F9 2370

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
364 367 2.290323 ACAGGGTGTGCATAAGAACCTC 60.29 50.0 0.0 0.0 33.02 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2135 2139 1.680207 GATGCTTGGATTTGCCTCCTC 59.32 52.381 0.0 0.0 36.2 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 5.356882 TGCCATCTGAAGAAGTTAAAACG 57.643 39.130 0.00 0.00 0.00 3.60
364 367 2.290323 ACAGGGTGTGCATAAGAACCTC 60.290 50.000 0.00 0.00 33.02 3.85
1304 1307 2.487805 CGGATGGGATGATGGACAATGT 60.488 50.000 0.00 0.00 0.00 2.71
1389 1392 1.648467 GGGAGGCAACATGCGACTTC 61.648 60.000 0.00 0.00 46.21 3.01
1468 1471 8.079203 GTCAAACATGTTGTAACACCAATCATA 58.921 33.333 12.82 0.00 42.51 2.15
2091 2095 6.936900 GTGACACCCTATATAGTGCATGAATT 59.063 38.462 8.92 0.00 37.51 2.17
2135 2139 0.898320 ACCTCCGTCCAATGACTGAG 59.102 55.000 7.04 7.04 46.54 3.35
2249 2253 4.742440 GCCAATCGTATGAGGTGGTTATGA 60.742 45.833 15.49 0.00 36.21 2.15
2281 2285 6.183360 GCGTGAATGAATCGAAGTTGTAGTAA 60.183 38.462 0.00 0.00 0.00 2.24
2365 2369 1.761174 GGTTTCCTGGCTCCTGTGA 59.239 57.895 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
364 367 4.720902 TGCATGGACACCCTGCCG 62.721 66.667 13.56 0.0 36.44 5.69
885 888 7.328737 GTTCTTATAATGTCCGTGCCCTATAT 58.671 38.462 0.00 0.0 0.00 0.86
1304 1307 7.825761 CCCTTTAGTCTTTTAAACCTATTCCGA 59.174 37.037 0.00 0.0 0.00 4.55
2091 2095 7.931578 AATTCAACGGATGGTATTCAAAGTA 57.068 32.000 0.00 0.0 0.00 2.24
2135 2139 1.680207 GATGCTTGGATTTGCCTCCTC 59.320 52.381 0.00 0.0 36.20 3.71
2249 2253 1.740380 CGATTCATTCACGCCAGACCT 60.740 52.381 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.