Multiple sequence alignment - TraesCS2D01G594000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G594000 chr2D 100.000 2472 0 0 1 2472 648148569 648151040 0.000000e+00 4566.0
1 TraesCS2D01G594000 chr2D 95.462 1873 68 11 1 1868 349010866 349009006 0.000000e+00 2972.0
2 TraesCS2D01G594000 chr2D 95.099 1877 71 14 1 1870 60191051 60189189 0.000000e+00 2937.0
3 TraesCS2D01G594000 chr2D 93.348 1879 60 21 1 1868 147957646 147959470 0.000000e+00 2717.0
4 TraesCS2D01G594000 chr2D 95.079 1585 63 8 290 1870 56318390 56319963 0.000000e+00 2481.0
5 TraesCS2D01G594000 chr2D 97.980 99 2 0 1772 1870 370187868 370187770 3.270000e-39 172.0
6 TraesCS2D01G594000 chr5D 95.157 1879 75 12 1 1869 304009276 304011148 0.000000e+00 2952.0
7 TraesCS2D01G594000 chr5D 94.877 1874 79 10 1 1870 432505714 432507574 0.000000e+00 2913.0
8 TraesCS2D01G594000 chr3D 95.152 1877 80 7 1 1869 154056648 154058521 0.000000e+00 2952.0
9 TraesCS2D01G594000 chr7D 94.981 1873 80 8 1 1869 460639781 460637919 0.000000e+00 2926.0
10 TraesCS2D01G594000 chr6D 95.027 1870 78 8 1 1867 359439057 359437200 0.000000e+00 2924.0
11 TraesCS2D01G594000 chr6D 94.877 1874 79 10 3 1869 11364955 11366818 0.000000e+00 2913.0
12 TraesCS2D01G594000 chr6D 95.164 641 20 5 1236 1875 97919947 97920577 0.000000e+00 1002.0
13 TraesCS2D01G594000 chr1D 95.503 1779 69 7 1 1776 61782356 61780586 0.000000e+00 2832.0
14 TraesCS2D01G594000 chr2A 98.185 606 11 0 1867 2472 689662823 689663428 0.000000e+00 1059.0
15 TraesCS2D01G594000 chr2A 97.533 608 13 1 1867 2472 54809332 54809939 0.000000e+00 1038.0
16 TraesCS2D01G594000 chr2A 97.533 608 13 1 1867 2472 179957905 179957298 0.000000e+00 1038.0
17 TraesCS2D01G594000 chr2A 97.533 608 13 1 1867 2472 423119469 423118862 0.000000e+00 1038.0
18 TraesCS2D01G594000 chr3A 98.026 608 10 1 1867 2472 103507976 103507369 0.000000e+00 1055.0
19 TraesCS2D01G594000 chr3A 97.697 608 11 2 1867 2472 606182217 606181611 0.000000e+00 1042.0
20 TraesCS2D01G594000 chr3A 97.533 608 13 1 1867 2472 192536187 192535580 0.000000e+00 1038.0
21 TraesCS2D01G594000 chr3A 97.533 608 13 1 1867 2472 385864759 385865366 0.000000e+00 1038.0
22 TraesCS2D01G594000 chr2B 98.026 608 9 2 1867 2472 731655078 731655684 0.000000e+00 1053.0
23 TraesCS2D01G594000 chr7A 91.101 427 26 5 1454 1880 154786562 154786976 3.570000e-158 568.0
24 TraesCS2D01G594000 chr5A 100.000 30 0 0 1747 1776 24360915 24360944 3.430000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G594000 chr2D 648148569 648151040 2471 False 4566 4566 100.000 1 2472 1 chr2D.!!$F3 2471
1 TraesCS2D01G594000 chr2D 349009006 349010866 1860 True 2972 2972 95.462 1 1868 1 chr2D.!!$R2 1867
2 TraesCS2D01G594000 chr2D 60189189 60191051 1862 True 2937 2937 95.099 1 1870 1 chr2D.!!$R1 1869
3 TraesCS2D01G594000 chr2D 147957646 147959470 1824 False 2717 2717 93.348 1 1868 1 chr2D.!!$F2 1867
4 TraesCS2D01G594000 chr2D 56318390 56319963 1573 False 2481 2481 95.079 290 1870 1 chr2D.!!$F1 1580
5 TraesCS2D01G594000 chr5D 304009276 304011148 1872 False 2952 2952 95.157 1 1869 1 chr5D.!!$F1 1868
6 TraesCS2D01G594000 chr5D 432505714 432507574 1860 False 2913 2913 94.877 1 1870 1 chr5D.!!$F2 1869
7 TraesCS2D01G594000 chr3D 154056648 154058521 1873 False 2952 2952 95.152 1 1869 1 chr3D.!!$F1 1868
8 TraesCS2D01G594000 chr7D 460637919 460639781 1862 True 2926 2926 94.981 1 1869 1 chr7D.!!$R1 1868
9 TraesCS2D01G594000 chr6D 359437200 359439057 1857 True 2924 2924 95.027 1 1867 1 chr6D.!!$R1 1866
10 TraesCS2D01G594000 chr6D 11364955 11366818 1863 False 2913 2913 94.877 3 1869 1 chr6D.!!$F1 1866
11 TraesCS2D01G594000 chr6D 97919947 97920577 630 False 1002 1002 95.164 1236 1875 1 chr6D.!!$F2 639
12 TraesCS2D01G594000 chr1D 61780586 61782356 1770 True 2832 2832 95.503 1 1776 1 chr1D.!!$R1 1775
13 TraesCS2D01G594000 chr2A 689662823 689663428 605 False 1059 1059 98.185 1867 2472 1 chr2A.!!$F2 605
14 TraesCS2D01G594000 chr2A 54809332 54809939 607 False 1038 1038 97.533 1867 2472 1 chr2A.!!$F1 605
15 TraesCS2D01G594000 chr2A 179957298 179957905 607 True 1038 1038 97.533 1867 2472 1 chr2A.!!$R1 605
16 TraesCS2D01G594000 chr2A 423118862 423119469 607 True 1038 1038 97.533 1867 2472 1 chr2A.!!$R2 605
17 TraesCS2D01G594000 chr3A 103507369 103507976 607 True 1055 1055 98.026 1867 2472 1 chr3A.!!$R1 605
18 TraesCS2D01G594000 chr3A 606181611 606182217 606 True 1042 1042 97.697 1867 2472 1 chr3A.!!$R3 605
19 TraesCS2D01G594000 chr3A 192535580 192536187 607 True 1038 1038 97.533 1867 2472 1 chr3A.!!$R2 605
20 TraesCS2D01G594000 chr3A 385864759 385865366 607 False 1038 1038 97.533 1867 2472 1 chr3A.!!$F1 605
21 TraesCS2D01G594000 chr2B 731655078 731655684 606 False 1053 1053 98.026 1867 2472 1 chr2B.!!$F1 605

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
299 304 1.134848 GCTTGTCGAGGAGCTCTGAAT 60.135 52.381 14.64 0.0 36.01 2.57 F
1096 1118 0.033011 GTGGAGAGGCAGGAGGTCTA 60.033 60.000 0.00 0.0 0.00 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1115 1137 1.280710 TCGCATAAACACCTCCACCAT 59.719 47.619 0.0 0.0 0.00 3.55 R
2066 2107 2.825532 TGCTTAGCTTTGGGTTCAATCC 59.174 45.455 5.6 0.0 32.28 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
295 300 4.432601 AGCTTGTCGAGGAGCTCT 57.567 55.556 14.64 0.00 45.68 4.09
299 304 1.134848 GCTTGTCGAGGAGCTCTGAAT 60.135 52.381 14.64 0.00 36.01 2.57
409 414 2.895372 ATTGCCGTTCGATCCGCC 60.895 61.111 4.69 0.00 0.00 6.13
551 557 4.445710 TCCGCCATGGCCATTGCT 62.446 61.111 32.22 5.42 37.80 3.91
641 648 3.939837 CTGCCGCTCTTCTTCCGCA 62.940 63.158 0.00 0.00 0.00 5.69
749 756 4.935495 CACCACTGTGCCCTGCGT 62.935 66.667 1.29 0.00 35.31 5.24
752 761 2.359107 CACTGTGCCCTGCGTGAT 60.359 61.111 0.00 0.00 0.00 3.06
1096 1118 0.033011 GTGGAGAGGCAGGAGGTCTA 60.033 60.000 0.00 0.00 0.00 2.59
1758 1795 4.674281 AAAACCCAGCGAAAATAAACCA 57.326 36.364 0.00 0.00 0.00 3.67
1775 1812 4.927267 AACCATGGAGACTATTCACCAA 57.073 40.909 21.47 0.00 44.65 3.67
2066 2107 1.672356 CTGGGAAAGGACACCGCAG 60.672 63.158 0.00 0.00 0.00 5.18
2310 2353 3.108376 AGAGAGGGGGAGAACATTGTAC 58.892 50.000 0.00 0.00 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 137 1.828768 GAGGAGGAGTGAGGCCATG 59.171 63.158 5.01 0.0 0.00 3.66
295 300 1.067142 ACGAAGTAGCGAAGGCATTCA 60.067 47.619 12.16 0.0 41.94 2.57
389 394 1.977594 GCGGATCGAACGGCAATGTT 61.978 55.000 18.25 0.0 36.40 2.71
551 557 4.715130 AGCTCGGTGGCTACCCCA 62.715 66.667 14.41 0.0 44.53 4.96
720 727 4.367023 GTGGTGCGGTGGCTACGA 62.367 66.667 5.63 0.0 40.82 3.43
749 756 1.916273 ACGGCCAGGGTGTGTATCA 60.916 57.895 2.24 0.0 0.00 2.15
752 761 4.323477 GCACGGCCAGGGTGTGTA 62.323 66.667 2.24 0.0 37.70 2.90
1115 1137 1.280710 TCGCATAAACACCTCCACCAT 59.719 47.619 0.00 0.0 0.00 3.55
1230 1263 2.489938 TTGAAGGAAATCACCCCTCG 57.510 50.000 0.00 0.0 31.17 4.63
1758 1795 3.200825 CCACCTTGGTGAATAGTCTCCAT 59.799 47.826 20.27 0.0 44.78 3.41
2066 2107 2.825532 TGCTTAGCTTTGGGTTCAATCC 59.174 45.455 5.60 0.0 32.28 3.01
2310 2353 6.092533 GCTTCTTCTCTCTTTTTGGATCTCAG 59.907 42.308 0.00 0.0 0.00 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.