Multiple sequence alignment - TraesCS2D01G593000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G593000 chr2D 100.000 4802 0 0 1 4802 647826085 647830886 0.000000e+00 8868
1 TraesCS2D01G593000 chr2D 98.505 3144 41 2 757 3900 50734243 50737380 0.000000e+00 5541
2 TraesCS2D01G593000 chr2D 98.353 911 14 1 3893 4802 545774975 545774065 0.000000e+00 1598
3 TraesCS2D01G593000 chr6D 98.567 3141 39 2 760 3900 426833548 426830414 0.000000e+00 5546
4 TraesCS2D01G593000 chr6D 98.377 3142 43 4 760 3900 444645159 444642025 0.000000e+00 5513
5 TraesCS2D01G593000 chr6D 96.252 587 11 4 4 580 444646366 444645781 0.000000e+00 952
6 TraesCS2D01G593000 chr6D 94.674 582 23 3 2 580 436563364 436562788 0.000000e+00 896
7 TraesCS2D01G593000 chr6D 98.404 188 2 1 575 762 88996373 88996559 3.580000e-86 329
8 TraesCS2D01G593000 chr6D 97.872 188 4 0 575 762 426834004 426833817 4.630000e-85 326
9 TraesCS2D01G593000 chr4D 98.506 3145 40 3 757 3900 459656661 459659799 0.000000e+00 5541
10 TraesCS2D01G593000 chr4D 98.463 911 13 1 3893 4802 459661018 459661928 0.000000e+00 1604
11 TraesCS2D01G593000 chr4D 98.134 911 16 1 3893 4802 369885838 369886748 0.000000e+00 1587
12 TraesCS2D01G593000 chr4D 98.936 188 2 0 575 762 459656208 459656395 2.140000e-88 337
13 TraesCS2D01G593000 chr4D 97.872 188 4 0 575 762 359602579 359602766 4.630000e-85 326
14 TraesCS2D01G593000 chr1D 98.535 3139 40 2 760 3898 125861325 125858193 0.000000e+00 5537
15 TraesCS2D01G593000 chr1D 98.472 3142 41 3 757 3898 240732601 240735735 0.000000e+00 5529
16 TraesCS2D01G593000 chr1D 98.353 911 14 1 3893 4802 10449918 10449008 0.000000e+00 1598
17 TraesCS2D01G593000 chr1D 97.582 579 11 1 1 576 240731402 240731980 0.000000e+00 989
18 TraesCS2D01G593000 chr1D 97.872 188 4 0 575 762 240732148 240732335 4.630000e-85 326
19 TraesCS2D01G593000 chr7D 98.504 3141 40 3 760 3900 18977010 18973877 0.000000e+00 5533
20 TraesCS2D01G593000 chr7D 98.313 3142 44 4 760 3900 555024573 555021440 0.000000e+00 5500
21 TraesCS2D01G593000 chr7D 98.793 911 10 1 3893 4802 18972560 18971650 0.000000e+00 1620
22 TraesCS2D01G593000 chr7D 97.931 580 9 1 1 577 86374122 86374701 0.000000e+00 1002
23 TraesCS2D01G593000 chr7D 98.936 188 2 0 575 762 86374869 86375056 2.140000e-88 337
24 TraesCS2D01G593000 chr5D 98.249 3141 45 3 760 3900 70869487 70866357 0.000000e+00 5487
25 TraesCS2D01G593000 chr5D 98.134 911 16 1 3893 4802 135668470 135667560 0.000000e+00 1587
26 TraesCS2D01G593000 chr5D 95.932 590 11 5 1 580 532817195 532816609 0.000000e+00 944
27 TraesCS2D01G593000 chr5D 94.719 587 19 7 2 580 70870538 70869956 0.000000e+00 902
28 TraesCS2D01G593000 chr5D 94.539 586 20 5 2 577 486772364 486772947 0.000000e+00 894
29 TraesCS2D01G593000 chr5D 93.664 584 25 6 2 577 363112076 363112655 0.000000e+00 863
30 TraesCS2D01G593000 chr5D 98.404 188 3 0 575 762 502403518 502403331 9.960000e-87 331
31 TraesCS2D01G593000 chr5D 98.413 189 2 1 575 762 532816444 532816256 9.960000e-87 331
32 TraesCS2D01G593000 chr5D 97.872 188 4 0 575 762 449485473 449485286 4.630000e-85 326
33 TraesCS2D01G593000 chr3D 98.463 911 13 1 3893 4802 11675710 11674800 0.000000e+00 1604
34 TraesCS2D01G593000 chr3D 98.463 911 13 1 3893 4802 330708167 330707257 0.000000e+00 1604
35 TraesCS2D01G593000 chr3D 98.134 911 16 1 3893 4802 121314329 121315239 0.000000e+00 1587
36 TraesCS2D01G593000 chr3D 95.255 548 17 4 36 580 422020614 422020073 0.000000e+00 859


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G593000 chr2D 647826085 647830886 4801 False 8868.000000 8868 100.000000 1 4802 1 chr2D.!!$F2 4801
1 TraesCS2D01G593000 chr2D 50734243 50737380 3137 False 5541.000000 5541 98.505000 757 3900 1 chr2D.!!$F1 3143
2 TraesCS2D01G593000 chr2D 545774065 545774975 910 True 1598.000000 1598 98.353000 3893 4802 1 chr2D.!!$R1 909
3 TraesCS2D01G593000 chr6D 444642025 444646366 4341 True 3232.500000 5513 97.314500 4 3900 2 chr6D.!!$R3 3896
4 TraesCS2D01G593000 chr6D 426830414 426834004 3590 True 2936.000000 5546 98.219500 575 3900 2 chr6D.!!$R2 3325
5 TraesCS2D01G593000 chr6D 436562788 436563364 576 True 896.000000 896 94.674000 2 580 1 chr6D.!!$R1 578
6 TraesCS2D01G593000 chr4D 459656208 459661928 5720 False 2494.000000 5541 98.635000 575 4802 3 chr4D.!!$F3 4227
7 TraesCS2D01G593000 chr4D 369885838 369886748 910 False 1587.000000 1587 98.134000 3893 4802 1 chr4D.!!$F2 909
8 TraesCS2D01G593000 chr1D 125858193 125861325 3132 True 5537.000000 5537 98.535000 760 3898 1 chr1D.!!$R2 3138
9 TraesCS2D01G593000 chr1D 240731402 240735735 4333 False 2281.333333 5529 97.975333 1 3898 3 chr1D.!!$F1 3897
10 TraesCS2D01G593000 chr1D 10449008 10449918 910 True 1598.000000 1598 98.353000 3893 4802 1 chr1D.!!$R1 909
11 TraesCS2D01G593000 chr7D 555021440 555024573 3133 True 5500.000000 5500 98.313000 760 3900 1 chr7D.!!$R1 3140
12 TraesCS2D01G593000 chr7D 18971650 18977010 5360 True 3576.500000 5533 98.648500 760 4802 2 chr7D.!!$R2 4042
13 TraesCS2D01G593000 chr7D 86374122 86375056 934 False 669.500000 1002 98.433500 1 762 2 chr7D.!!$F1 761
14 TraesCS2D01G593000 chr5D 70866357 70870538 4181 True 3194.500000 5487 96.484000 2 3900 2 chr5D.!!$R4 3898
15 TraesCS2D01G593000 chr5D 135667560 135668470 910 True 1587.000000 1587 98.134000 3893 4802 1 chr5D.!!$R1 909
16 TraesCS2D01G593000 chr5D 486772364 486772947 583 False 894.000000 894 94.539000 2 577 1 chr5D.!!$F2 575
17 TraesCS2D01G593000 chr5D 363112076 363112655 579 False 863.000000 863 93.664000 2 577 1 chr5D.!!$F1 575
18 TraesCS2D01G593000 chr5D 532816256 532817195 939 True 637.500000 944 97.172500 1 762 2 chr5D.!!$R5 761
19 TraesCS2D01G593000 chr3D 11674800 11675710 910 True 1604.000000 1604 98.463000 3893 4802 1 chr3D.!!$R1 909
20 TraesCS2D01G593000 chr3D 330707257 330708167 910 True 1604.000000 1604 98.463000 3893 4802 1 chr3D.!!$R2 909
21 TraesCS2D01G593000 chr3D 121314329 121315239 910 False 1587.000000 1587 98.134000 3893 4802 1 chr3D.!!$F1 909
22 TraesCS2D01G593000 chr3D 422020073 422020614 541 True 859.000000 859 95.255000 36 580 1 chr3D.!!$R3 544

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
470 487 3.141398 CGTAGGTGCTCCGGTAGTATAA 58.859 50.000 0.0 0.0 39.05 0.98 F
1446 2023 0.827368 GCAGTCAGGTAGAAGGAGGG 59.173 60.000 0.0 0.0 0.00 4.30 F
2078 2656 1.001378 GCAGACAAAAGTGTTCGCCAT 60.001 47.619 0.0 0.0 38.41 4.40 F
3327 3906 2.618241 TGCAAATGAGTTGAGGACACAC 59.382 45.455 0.0 0.0 39.87 3.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2235 2813 2.575735 TGGGAACTCTGGCATGAACATA 59.424 45.455 0.00 0.0 0.00 2.29 R
3324 3903 1.686355 TGCCAATTTTCACCTCGTGT 58.314 45.000 0.00 0.0 34.79 4.49 R
3766 4345 1.486211 GCCCTTACTCCTCTACTGCA 58.514 55.000 0.00 0.0 0.00 4.41 R
4191 6089 0.324943 GGAGGTAGCTCCAACTGCAA 59.675 55.000 31.56 0.0 42.86 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
470 487 3.141398 CGTAGGTGCTCCGGTAGTATAA 58.859 50.000 0.00 0.00 39.05 0.98
1018 1595 3.312697 CGAGATGTCCGATGTAGTGAAGA 59.687 47.826 0.00 0.00 0.00 2.87
1446 2023 0.827368 GCAGTCAGGTAGAAGGAGGG 59.173 60.000 0.00 0.00 0.00 4.30
1771 2348 1.003118 TGTATCCGAACAAGCAAGCCT 59.997 47.619 0.00 0.00 0.00 4.58
2078 2656 1.001378 GCAGACAAAAGTGTTCGCCAT 60.001 47.619 0.00 0.00 38.41 4.40
2235 2813 6.041409 CAGGCACCTATATCGATATCCAAGAT 59.959 42.308 20.95 0.00 0.00 2.40
2344 2922 3.070748 CAACCGGTGATATGTGTTGACA 58.929 45.455 8.52 0.00 38.81 3.58
2970 3548 3.161067 GTGGATAGAGCATGAGCCTCTA 58.839 50.000 9.98 9.98 43.56 2.43
3145 3723 8.304596 AGTATTTCAGAGACAGACGTCAAATAA 58.695 33.333 19.50 0.00 45.23 1.40
3324 3903 2.929641 TGTGCAAATGAGTTGAGGACA 58.070 42.857 0.00 0.00 39.87 4.02
3327 3906 2.618241 TGCAAATGAGTTGAGGACACAC 59.382 45.455 0.00 0.00 39.87 3.82
3349 3928 3.674753 CGAGGTGAAAATTGGCAATGAAC 59.325 43.478 14.47 9.48 0.00 3.18
3363 3942 3.670377 GAACCCTGGCCAACGTGC 61.670 66.667 7.01 0.00 0.00 5.34
3419 3998 3.492102 ACCTTGCTCACATGTACTTGT 57.508 42.857 8.51 8.51 0.00 3.16
3527 4106 2.749621 AGCTGATGGGTTTTCGATCAAC 59.250 45.455 0.00 0.00 39.52 3.18
3712 4291 4.699925 GGCCATAGGGACACTAATTGTA 57.300 45.455 0.00 0.00 44.16 2.41
3766 4345 2.425102 CGGGGAAGAAGAGGAGGTAGAT 60.425 54.545 0.00 0.00 0.00 1.98
3941 5838 3.259064 TGCTAGCGGCTACTAACTTTTG 58.741 45.455 10.77 0.00 42.39 2.44
4191 6089 4.222810 GGGTTATGAGGCAATTTGGTCTTT 59.777 41.667 0.00 0.00 0.00 2.52
4287 6185 9.545105 TTCAATGTTGCATTTTCTTTCATAGTT 57.455 25.926 0.00 0.00 0.00 2.24
4299 6197 9.965824 TTTTCTTTCATAGTTCTCCATTCAAAC 57.034 29.630 0.00 0.00 0.00 2.93
4582 6480 4.466827 TGTACCCGAGCTATGATACTTCA 58.533 43.478 0.00 0.00 36.00 3.02
4670 6568 6.018751 TGCAAGAGACAGACATTATTAATCGC 60.019 38.462 0.00 0.00 0.00 4.58
4787 6685 1.073923 CCAGTGGTACAGCCCTTCTTT 59.926 52.381 0.00 0.00 41.80 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 35 2.758130 AGAATGGAGGAAGGAGAGGAC 58.242 52.381 0.00 0.00 0.00 3.85
470 487 5.894964 ACCGGGGCAAATAACAATATTTACT 59.105 36.000 6.32 0.00 39.21 2.24
909 1485 5.983720 AGGACCATAGTAAATTTCACGATCG 59.016 40.000 14.88 14.88 0.00 3.69
1018 1595 6.831664 ACCAGGACCATAGTAAAATCTCAT 57.168 37.500 0.00 0.00 0.00 2.90
1771 2348 6.991531 GCCCAATTAATTATTGCATCCTTCAA 59.008 34.615 0.00 0.00 41.93 2.69
2078 2656 7.446931 TGCCATAAGAAATTCTGTACTTCAACA 59.553 33.333 0.00 0.00 0.00 3.33
2235 2813 2.575735 TGGGAACTCTGGCATGAACATA 59.424 45.455 0.00 0.00 0.00 2.29
2324 2902 3.244422 ACTGTCAACACATATCACCGGTT 60.244 43.478 2.97 0.00 0.00 4.44
2344 2922 4.423625 ACTTGCCTGTGAGAAAAGTACT 57.576 40.909 0.00 0.00 29.56 2.73
2970 3548 2.609747 TGTAGCAAAGACCACCTCTCT 58.390 47.619 0.00 0.00 0.00 3.10
3145 3723 5.182001 GGTTGTTCAAGATATGTTGCTCTGT 59.818 40.000 7.71 0.00 0.00 3.41
3324 3903 1.686355 TGCCAATTTTCACCTCGTGT 58.314 45.000 0.00 0.00 34.79 4.49
3327 3906 3.574284 TCATTGCCAATTTTCACCTCG 57.426 42.857 0.00 0.00 0.00 4.63
3419 3998 3.980989 CAAGCTGCCCGCAAGCAA 61.981 61.111 11.76 0.00 43.52 3.91
3527 4106 1.801771 TGACGCTGTTGAAATTACCCG 59.198 47.619 0.00 0.00 0.00 5.28
3766 4345 1.486211 GCCCTTACTCCTCTACTGCA 58.514 55.000 0.00 0.00 0.00 4.41
4191 6089 0.324943 GGAGGTAGCTCCAACTGCAA 59.675 55.000 31.56 0.00 42.86 4.08
4299 6197 6.915843 GTGTGTGTTCAACAATTACCTAAAGG 59.084 38.462 0.00 0.00 41.57 3.11
4506 6404 2.039879 GGGTGGGAGTACTCAACAATGT 59.960 50.000 23.91 0.00 35.60 2.71
4582 6480 2.482333 CGCGTACTGCCTAGAGCCT 61.482 63.158 0.00 0.00 42.71 4.58
4670 6568 2.159057 GGTAGCCTGCAAATTTCCATGG 60.159 50.000 4.97 4.97 0.00 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.