Multiple sequence alignment - TraesCS2D01G592400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G592400 chr2D 100.000 2448 0 0 797 3244 647509492 647511939 0.000000e+00 4521.0
1 TraesCS2D01G592400 chr2D 100.000 257 0 0 1 257 647508696 647508952 2.930000e-130 475.0
2 TraesCS2D01G592400 chr2A 97.896 2472 15 4 797 3244 772967766 772965308 0.000000e+00 4242.0
3 TraesCS2D01G592400 chr2A 99.222 257 2 0 1 257 772968206 772967950 6.340000e-127 464.0
4 TraesCS2D01G592400 chr2B 89.181 647 66 1 1629 2275 788535170 788534528 0.000000e+00 804.0
5 TraesCS2D01G592400 chr2B 87.630 671 45 20 2598 3244 788525365 788524709 0.000000e+00 745.0
6 TraesCS2D01G592400 chr2B 92.632 475 26 7 2746 3218 788534112 788533645 0.000000e+00 675.0
7 TraesCS2D01G592400 chr2B 93.182 396 14 3 797 1189 788538828 788538443 1.310000e-158 569.0
8 TraesCS2D01G592400 chr2B 88.305 419 26 9 1241 1636 788537558 788537140 6.290000e-132 481.0
9 TraesCS2D01G592400 chr2B 88.158 228 11 4 45 257 788539244 788539018 1.150000e-64 257.0
10 TraesCS2D01G592400 chr2B 92.414 145 11 0 2375 2519 788525527 788525383 1.180000e-49 207.0
11 TraesCS2D01G592400 chr2B 84.536 97 4 1 2423 2519 788534333 788534248 5.770000e-13 86.1
12 TraesCS2D01G592400 chr2B 95.000 40 2 0 2346 2385 788531195 788531156 2.700000e-06 63.9
13 TraesCS2D01G592400 chr4B 90.698 43 4 0 138 180 665292818 665292776 1.260000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G592400 chr2D 647508696 647511939 3243 False 2498.000000 4521 100.000 1 3244 2 chr2D.!!$F1 3243
1 TraesCS2D01G592400 chr2A 772965308 772968206 2898 True 2353.000000 4242 98.559 1 3244 2 chr2A.!!$R1 3243
2 TraesCS2D01G592400 chr2B 788524709 788525527 818 True 476.000000 745 90.022 2375 3244 2 chr2B.!!$R1 869
3 TraesCS2D01G592400 chr2B 788531156 788539244 8088 True 419.428571 804 90.142 45 3218 7 chr2B.!!$R2 3173

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1224 2089 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.0 0.0 0.0 0.0 3.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3222 6227 1.006832 ACATCGTGCCGTTATCAAGC 58.993 50.0 0.0 0.0 0.0 4.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1224 2089 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.0 0.0 0.00 3.10
1225 2090 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.0 0.0 0.00 3.20
1226 2091 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.0 0.0 0.00 3.10
1227 2092 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.0 0.0 0.00 3.20
1228 2093 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.0 0.0 0.00 3.10
1229 2094 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.0 0.0 0.00 3.20
1230 2095 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.0 0.0 0.00 3.10
1231 2096 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.0 0.0 0.00 3.20
1232 2097 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.0 0.0 0.00 3.10
1233 2098 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.0 0.0 0.00 3.20
1592 2501 7.288810 AGAAAAACTGCCACTGAAATATCAA 57.711 32.000 0.0 0.0 34.49 2.57
1691 4577 4.819630 TCTTTGTTAAGTGGCAAGTACCAG 59.180 41.667 0.0 0.0 41.46 4.00
3222 6227 7.221452 CAGATTTCAGACTTTCACCACAAAAAG 59.779 37.037 0.0 0.0 38.24 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1224 2089 5.414789 TTTCGAAGAGAGAGAGAGAGAGA 57.585 43.478 0.00 0.0 38.43 3.10
1225 2090 6.458751 CCAATTTCGAAGAGAGAGAGAGAGAG 60.459 46.154 0.00 0.0 38.43 3.20
1226 2091 5.356751 CCAATTTCGAAGAGAGAGAGAGAGA 59.643 44.000 0.00 0.0 38.43 3.10
1227 2092 5.356751 TCCAATTTCGAAGAGAGAGAGAGAG 59.643 44.000 0.00 0.0 38.43 3.20
1228 2093 5.124776 GTCCAATTTCGAAGAGAGAGAGAGA 59.875 44.000 0.00 0.0 38.43 3.10
1229 2094 5.339990 GTCCAATTTCGAAGAGAGAGAGAG 58.660 45.833 0.00 0.0 38.43 3.20
1230 2095 4.142578 CGTCCAATTTCGAAGAGAGAGAGA 60.143 45.833 0.00 0.0 38.43 3.10
1231 2096 4.101942 CGTCCAATTTCGAAGAGAGAGAG 58.898 47.826 0.00 0.0 38.43 3.20
1232 2097 3.119459 CCGTCCAATTTCGAAGAGAGAGA 60.119 47.826 0.00 0.0 38.43 3.10
1233 2098 3.182967 CCGTCCAATTTCGAAGAGAGAG 58.817 50.000 0.00 0.0 38.43 3.20
1691 4577 1.474330 CTTGGGGTGGCTTGATTACC 58.526 55.000 0.00 0.0 0.00 2.85
2344 5294 5.811399 TTATGCAATTTCTCCCTTACACG 57.189 39.130 0.00 0.0 0.00 4.49
2536 5511 2.185004 TGCTGAGCTAAAAGGTGACC 57.815 50.000 5.83 0.0 0.00 4.02
3222 6227 1.006832 ACATCGTGCCGTTATCAAGC 58.993 50.000 0.00 0.0 0.00 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.