Multiple sequence alignment - TraesCS2D01G592300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G592300 chr2D 100.000 4017 0 0 1 4017 647442131 647438115 0.000000e+00 7419.0
1 TraesCS2D01G592300 chr2D 81.462 1327 212 24 1923 3233 647432122 647430814 0.000000e+00 1057.0
2 TraesCS2D01G592300 chr2D 74.356 932 195 32 2309 3215 647486209 647485297 1.370000e-94 357.0
3 TraesCS2D01G592300 chr2D 89.474 76 8 0 3234 3309 647662168 647662243 3.300000e-16 97.1
4 TraesCS2D01G592300 chr2D 93.478 46 3 0 717 762 127311448 127311493 7.200000e-08 69.4
5 TraesCS2D01G592300 chr2A 99.453 2558 13 1 1460 4017 773064470 773067026 0.000000e+00 4645.0
6 TraesCS2D01G592300 chr2A 94.403 1465 25 20 1 1462 773062899 773064309 0.000000e+00 2198.0
7 TraesCS2D01G592300 chr2A 81.139 1405 224 29 1923 3311 773074339 773075718 0.000000e+00 1088.0
8 TraesCS2D01G592300 chr2A 73.867 949 194 39 2309 3231 772996733 772997653 2.990000e-86 329.0
9 TraesCS2D01G592300 chr2A 91.429 70 6 0 3240 3309 772751764 772751695 3.300000e-16 97.1
10 TraesCS2D01G592300 chr2B 92.654 2287 126 21 717 2978 788635501 788637770 0.000000e+00 3254.0
11 TraesCS2D01G592300 chr2B 91.153 1786 120 22 1784 3556 761280924 761279164 0.000000e+00 2388.0
12 TraesCS2D01G592300 chr2B 91.684 469 39 0 1 469 788634693 788635161 0.000000e+00 651.0
13 TraesCS2D01G592300 chr2B 86.313 358 31 11 3592 3935 761279192 761278839 1.360000e-99 374.0
14 TraesCS2D01G592300 chr2B 90.052 191 14 2 523 709 788635180 788635369 4.010000e-60 243.0
15 TraesCS2D01G592300 chr2B 78.947 247 40 9 2976 3215 788605103 788605344 1.490000e-34 158.0
16 TraesCS2D01G592300 chr2B 94.545 55 3 0 708 762 788635456 788635510 7.150000e-13 86.1
17 TraesCS2D01G592300 chr1A 82.770 1567 222 26 1666 3216 118507327 118508861 0.000000e+00 1354.0
18 TraesCS2D01G592300 chr1A 80.244 491 58 18 1175 1647 118506428 118506897 2.310000e-87 333.0
19 TraesCS2D01G592300 chr7B 86.232 138 12 4 3582 3712 513813356 513813493 4.180000e-30 143.0
20 TraesCS2D01G592300 chr7A 84.397 141 14 4 3582 3716 554494231 554494369 9.060000e-27 132.0
21 TraesCS2D01G592300 chr7D 83.962 106 15 2 1110 1213 206607776 206607671 2.550000e-17 100.0
22 TraesCS2D01G592300 chr7D 93.478 46 3 0 717 762 626858094 626858139 7.200000e-08 69.4
23 TraesCS2D01G592300 chr1B 93.617 47 3 0 717 763 17133140 17133186 2.000000e-08 71.3
24 TraesCS2D01G592300 chr4A 91.304 46 4 0 717 762 218047551 218047596 3.350000e-06 63.9
25 TraesCS2D01G592300 chr4A 92.308 39 3 0 1172 1210 19584319 19584281 5.610000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G592300 chr2D 647438115 647442131 4016 True 7419.000 7419 100.00000 1 4017 1 chr2D.!!$R2 4016
1 TraesCS2D01G592300 chr2D 647430814 647432122 1308 True 1057.000 1057 81.46200 1923 3233 1 chr2D.!!$R1 1310
2 TraesCS2D01G592300 chr2D 647485297 647486209 912 True 357.000 357 74.35600 2309 3215 1 chr2D.!!$R3 906
3 TraesCS2D01G592300 chr2A 773062899 773067026 4127 False 3421.500 4645 96.92800 1 4017 2 chr2A.!!$F3 4016
4 TraesCS2D01G592300 chr2A 773074339 773075718 1379 False 1088.000 1088 81.13900 1923 3311 1 chr2A.!!$F2 1388
5 TraesCS2D01G592300 chr2A 772996733 772997653 920 False 329.000 329 73.86700 2309 3231 1 chr2A.!!$F1 922
6 TraesCS2D01G592300 chr2B 761278839 761280924 2085 True 1381.000 2388 88.73300 1784 3935 2 chr2B.!!$R1 2151
7 TraesCS2D01G592300 chr2B 788634693 788637770 3077 False 1058.525 3254 92.23375 1 2978 4 chr2B.!!$F2 2977
8 TraesCS2D01G592300 chr1A 118506428 118508861 2433 False 843.500 1354 81.50700 1175 3216 2 chr1A.!!$F1 2041

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
924 1070 0.318441 CAGAAGAGGGTGCTGTTCGA 59.682 55.000 0.0 0.0 32.68 3.71 F
925 1071 1.066573 CAGAAGAGGGTGCTGTTCGAT 60.067 52.381 0.0 0.0 32.68 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2029 2781 1.328680 CAGAGATACACCATGCGTTGC 59.671 52.381 0.00 0.0 0.0 4.17 R
3070 3847 7.466746 AGATAGATACTCAGAGAATTCAGGC 57.533 40.000 8.44 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
849 995 4.974721 CCCACCCCAGCACCACAC 62.975 72.222 0.00 0.00 0.00 3.82
850 996 4.974721 CCACCCCAGCACCACACC 62.975 72.222 0.00 0.00 0.00 4.16
851 997 4.974721 CACCCCAGCACCACACCC 62.975 72.222 0.00 0.00 0.00 4.61
921 1067 4.809070 GCAGAAGAGGGTGCTGTT 57.191 55.556 0.00 0.00 36.71 3.16
922 1068 2.549332 GCAGAAGAGGGTGCTGTTC 58.451 57.895 0.00 0.00 36.71 3.18
923 1069 1.294659 GCAGAAGAGGGTGCTGTTCG 61.295 60.000 0.00 0.00 36.71 3.95
924 1070 0.318441 CAGAAGAGGGTGCTGTTCGA 59.682 55.000 0.00 0.00 32.68 3.71
925 1071 1.066573 CAGAAGAGGGTGCTGTTCGAT 60.067 52.381 0.00 0.00 32.68 3.59
936 1082 1.079405 TGTTCGATTCGACCAGGCC 60.079 57.895 8.55 0.00 34.89 5.19
3070 3847 6.311723 CAACGTTACCTATTAAACTTGCTGG 58.688 40.000 0.00 0.00 0.00 4.85
3274 4054 8.697507 ATGAAGGTTGTCTTTTCATCTTTAGT 57.302 30.769 0.00 0.00 37.02 2.24
3614 4401 3.840468 TCATGCTGTTGAACAATGATGC 58.160 40.909 8.24 4.42 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
204 205 5.725110 CTCGTGAGGATACAAATTTGGAG 57.275 43.478 21.74 11.05 41.41 3.86
849 995 4.662278 TGATAAAACAAAGTGAGAGGGGG 58.338 43.478 0.00 0.00 0.00 5.40
850 996 5.393461 GCATGATAAAACAAAGTGAGAGGGG 60.393 44.000 0.00 0.00 0.00 4.79
851 997 5.393461 GGCATGATAAAACAAAGTGAGAGGG 60.393 44.000 0.00 0.00 0.00 4.30
920 1066 2.183300 CGGCCTGGTCGAATCGAA 59.817 61.111 17.19 0.00 37.72 3.71
921 1067 4.508128 GCGGCCTGGTCGAATCGA 62.508 66.667 26.96 0.00 29.41 3.59
2029 2781 1.328680 CAGAGATACACCATGCGTTGC 59.671 52.381 0.00 0.00 0.00 4.17
3070 3847 7.466746 AGATAGATACTCAGAGAATTCAGGC 57.533 40.000 8.44 0.00 0.00 4.85
3274 4054 4.271661 TGCTGCATGAGTTCATTGGATAA 58.728 39.130 0.00 0.00 33.61 1.75
3312 4092 3.353836 CTTGGGGACACAACGCCG 61.354 66.667 0.00 0.00 44.26 6.46
3477 4258 6.204301 CAGGATAGTAGACTTGCCATTGATTG 59.796 42.308 0.00 0.00 0.00 2.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.