Multiple sequence alignment - TraesCS2D01G591700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G591700 chr2D 100.000 2786 0 0 1 2786 646947949 646950734 0.000000e+00 5145
1 TraesCS2D01G591700 chr2D 97.142 2239 60 3 552 2786 646850669 646852907 0.000000e+00 3777
2 TraesCS2D01G591700 chr2D 98.282 2037 33 2 750 2786 646787328 646789362 0.000000e+00 3567
3 TraesCS2D01G591700 chr2D 95.606 2185 59 16 610 2786 646916136 646918291 0.000000e+00 3469
4 TraesCS2D01G591700 chr2D 96.958 1808 49 3 552 2353 647000609 647002416 0.000000e+00 3029
5 TraesCS2D01G591700 chr2D 96.852 1747 52 3 552 2296 646971229 646972974 0.000000e+00 2918
6 TraesCS2D01G591700 chr2D 96.848 1745 54 1 552 2296 646809274 646811017 0.000000e+00 2916
7 TraesCS2D01G591700 chr2D 96.676 1745 55 3 552 2296 646893255 646894996 0.000000e+00 2898
8 TraesCS2D01G591700 chr2D 97.825 1471 30 1 552 2022 646870995 646872463 0.000000e+00 2538
9 TraesCS2D01G591700 chr2D 91.694 1818 133 13 976 2786 646633797 646631991 0.000000e+00 2505
10 TraesCS2D01G591700 chr2D 98.692 688 9 0 2099 2786 646872459 646873146 0.000000e+00 1221
11 TraesCS2D01G591700 chr2D 99.638 553 2 0 1 553 646937236 646937788 0.000000e+00 1011
12 TraesCS2D01G591700 chr2D 99.457 552 3 0 1 552 450928488 450929039 0.000000e+00 1003
13 TraesCS2D01G591700 chr2D 99.278 554 4 0 1 554 35218356 35217803 0.000000e+00 1002
14 TraesCS2D01G591700 chr2D 97.308 483 13 0 2304 2786 646811163 646811645 0.000000e+00 821
15 TraesCS2D01G591700 chr2D 96.894 483 15 0 2304 2786 646973120 646973602 0.000000e+00 809
16 TraesCS2D01G591700 chr2D 95.031 483 18 1 2304 2786 646895142 646895618 0.000000e+00 754
17 TraesCS2D01G591700 chr2D 98.082 417 8 0 2370 2786 647109631 647110047 0.000000e+00 726
18 TraesCS2D01G591700 chr1D 99.637 551 2 0 1 551 14207295 14206745 0.000000e+00 1007
19 TraesCS2D01G591700 chr1D 99.101 556 5 0 1 556 35839760 35839205 0.000000e+00 1000
20 TraesCS2D01G591700 chr5D 99.457 552 3 0 1 552 512460215 512460766 0.000000e+00 1003
21 TraesCS2D01G591700 chr5D 98.582 564 6 2 1 563 498421252 498420690 0.000000e+00 996
22 TraesCS2D01G591700 chr7D 98.421 570 6 3 1 569 326011960 326011393 0.000000e+00 1000
23 TraesCS2D01G591700 chr6D 98.757 563 5 2 1 563 395085781 395085221 0.000000e+00 1000
24 TraesCS2D01G591700 chr3B 84.332 217 28 4 1982 2197 4347058 4347269 1.010000e-49 207


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G591700 chr2D 646947949 646950734 2785 False 5145.0 5145 100.0000 1 2786 1 chr2D.!!$F6 2785
1 TraesCS2D01G591700 chr2D 646850669 646852907 2238 False 3777.0 3777 97.1420 552 2786 1 chr2D.!!$F3 2234
2 TraesCS2D01G591700 chr2D 646787328 646789362 2034 False 3567.0 3567 98.2820 750 2786 1 chr2D.!!$F2 2036
3 TraesCS2D01G591700 chr2D 646916136 646918291 2155 False 3469.0 3469 95.6060 610 2786 1 chr2D.!!$F4 2176
4 TraesCS2D01G591700 chr2D 647000609 647002416 1807 False 3029.0 3029 96.9580 552 2353 1 chr2D.!!$F7 1801
5 TraesCS2D01G591700 chr2D 646631991 646633797 1806 True 2505.0 2505 91.6940 976 2786 1 chr2D.!!$R2 1810
6 TraesCS2D01G591700 chr2D 646870995 646873146 2151 False 1879.5 2538 98.2585 552 2786 2 chr2D.!!$F10 2234
7 TraesCS2D01G591700 chr2D 646809274 646811645 2371 False 1868.5 2916 97.0780 552 2786 2 chr2D.!!$F9 2234
8 TraesCS2D01G591700 chr2D 646971229 646973602 2373 False 1863.5 2918 96.8730 552 2786 2 chr2D.!!$F12 2234
9 TraesCS2D01G591700 chr2D 646893255 646895618 2363 False 1826.0 2898 95.8535 552 2786 2 chr2D.!!$F11 2234
10 TraesCS2D01G591700 chr2D 646937236 646937788 552 False 1011.0 1011 99.6380 1 553 1 chr2D.!!$F5 552
11 TraesCS2D01G591700 chr2D 450928488 450929039 551 False 1003.0 1003 99.4570 1 552 1 chr2D.!!$F1 551
12 TraesCS2D01G591700 chr2D 35217803 35218356 553 True 1002.0 1002 99.2780 1 554 1 chr2D.!!$R1 553
13 TraesCS2D01G591700 chr1D 14206745 14207295 550 True 1007.0 1007 99.6370 1 551 1 chr1D.!!$R1 550
14 TraesCS2D01G591700 chr1D 35839205 35839760 555 True 1000.0 1000 99.1010 1 556 1 chr1D.!!$R2 555
15 TraesCS2D01G591700 chr5D 512460215 512460766 551 False 1003.0 1003 99.4570 1 552 1 chr5D.!!$F1 551
16 TraesCS2D01G591700 chr5D 498420690 498421252 562 True 996.0 996 98.5820 1 563 1 chr5D.!!$R1 562
17 TraesCS2D01G591700 chr7D 326011393 326011960 567 True 1000.0 1000 98.4210 1 569 1 chr7D.!!$R1 568
18 TraesCS2D01G591700 chr6D 395085221 395085781 560 True 1000.0 1000 98.7570 1 563 1 chr6D.!!$R1 562

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
940 953 3.15768 CCACCACCGTCTTCCCTT 58.842 61.111 0.0 0.0 0.0 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2440 2682 2.185004 ACATCAAGAACCCGAGTTGG 57.815 50.0 0.0 0.0 35.94 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
559 560 5.130350 GGCATATTTCCAACAGTTAGGCTA 58.870 41.667 0.00 0.0 0.00 3.93
664 665 7.840931 TGTATATCTGCTCTGAAACTGAAGAA 58.159 34.615 0.00 0.0 0.00 2.52
751 756 4.380843 TCACTCTCCAACTCTCTCTCTT 57.619 45.455 0.00 0.0 0.00 2.85
940 953 3.157680 CCACCACCGTCTTCCCTT 58.842 61.111 0.00 0.0 0.00 3.95
1100 1113 3.319198 GGGTGTCAGGGGCGAGAA 61.319 66.667 0.00 0.0 0.00 2.87
1328 1341 7.067859 CAGGAATTTCATTGATAAGAGCCTCAA 59.932 37.037 0.00 0.0 35.95 3.02
1391 1404 5.052481 CGATATCAAAGACATCAAGAGCCA 58.948 41.667 3.12 0.0 0.00 4.75
1449 1462 2.132517 TTGACAATGTGGCTGCTGCG 62.133 55.000 9.65 0.0 40.82 5.18
1779 1796 2.950309 GAGCATGCTCCATCAACTTGAT 59.050 45.455 33.31 0.7 37.11 2.57
2074 2177 5.510179 CGGAGGCGAATTTAGGTTCCTATTA 60.510 44.000 0.00 0.0 0.00 0.98
2179 2282 9.740710 AATCTTAGTACTCATGCTTAAAAAGGT 57.259 29.630 0.00 0.0 0.00 3.50
2268 2371 5.907945 GTCGAAGAAAAGTTGGTAAGCTTTC 59.092 40.000 3.20 0.0 39.69 2.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
559 560 7.267857 TGATTTCAAGATAGTCGTCACATGAT 58.732 34.615 0.00 0.00 0.00 2.45
664 665 2.688477 TGGGGAAATTTTGGAGCTTGT 58.312 42.857 0.00 0.00 0.00 3.16
751 756 4.164221 GGGATGGAGACCTGTCTTGAATTA 59.836 45.833 0.63 0.00 40.61 1.40
913 926 2.900273 GGTGGTGGCGATCTGCTA 59.100 61.111 8.94 1.26 45.43 3.49
968 981 2.238521 GCTATAGCTCAGCCTCTCAGT 58.761 52.381 17.75 0.00 38.21 3.41
1100 1113 1.347707 TCTCGGCTTTGAGGAACATGT 59.652 47.619 0.00 0.00 36.61 3.21
1147 1160 2.580962 GATTGGAGCCTCAGAAATCCC 58.419 52.381 0.00 0.00 0.00 3.85
1328 1341 0.468029 CTTGCCCTTGGTCAACAGGT 60.468 55.000 0.00 0.00 0.00 4.00
2074 2177 3.416156 GAAAGCATGGTCCTCAAGAACT 58.584 45.455 0.00 0.00 31.28 3.01
2179 2282 3.431626 CCAACTAGGGACGATGCATACAA 60.432 47.826 0.00 0.00 0.00 2.41
2268 2371 4.326826 TGGGAAGAATTGAGCTGTGTAAG 58.673 43.478 0.00 0.00 0.00 2.34
2440 2682 2.185004 ACATCAAGAACCCGAGTTGG 57.815 50.000 0.00 0.00 35.94 3.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.