Multiple sequence alignment - TraesCS2D01G591500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G591500 chr2D 100.000 2594 0 0 1 2594 646850120 646852713 0.000000e+00 4791
1 TraesCS2D01G591500 chr2D 97.963 2356 46 1 2 2355 647000061 647002416 0.000000e+00 4084
2 TraesCS2D01G591500 chr2D 96.953 2297 67 2 2 2298 646970681 646972974 0.000000e+00 3851
3 TraesCS2D01G591500 chr2D 96.865 2297 67 3 2 2298 646808726 646811017 0.000000e+00 3838
4 TraesCS2D01G591500 chr2D 96.604 2297 71 5 2 2298 646892707 646894996 0.000000e+00 3803
5 TraesCS2D01G591500 chr2D 97.062 2042 56 3 550 2591 646948500 646950537 0.000000e+00 3435
6 TraesCS2D01G591500 chr2D 97.034 2023 54 2 2 2024 646870447 646872463 0.000000e+00 3398
7 TraesCS2D01G591500 chr2D 96.129 1989 44 14 610 2594 646916138 646918097 0.000000e+00 3216
8 TraesCS2D01G591500 chr2D 97.340 1842 46 2 750 2591 646787328 646789166 0.000000e+00 3127
9 TraesCS2D01G591500 chr2D 90.831 1625 131 13 976 2594 646633797 646632185 0.000000e+00 2159
10 TraesCS2D01G591500 chr2D 96.270 1126 39 2 2 1126 647101599 647102722 0.000000e+00 1844
11 TraesCS2D01G591500 chr2D 97.099 586 17 0 2 587 646786742 646787327 0.000000e+00 989
12 TraesCS2D01G591500 chr2D 86.809 887 71 22 553 1424 646765238 646766093 0.000000e+00 948
13 TraesCS2D01G591500 chr2D 92.157 663 30 5 2 649 646736777 646736122 0.000000e+00 917
14 TraesCS2D01G591500 chr2D 96.396 555 18 2 2 554 646935515 646936069 0.000000e+00 913
15 TraesCS2D01G591500 chr2D 98.167 491 9 0 2101 2591 646872459 646872949 0.000000e+00 857
16 TraesCS2D01G591500 chr2D 99.005 402 4 0 2 403 646831753 646832154 0.000000e+00 721
17 TraesCS2D01G591500 chr2D 97.552 286 7 0 2306 2591 646811163 646811448 8.340000e-135 490
18 TraesCS2D01G591500 chr2D 97.203 286 8 0 2306 2591 646973120 646973405 3.880000e-133 484
19 TraesCS2D01G591500 chr2D 94.755 286 9 1 2306 2591 646895142 646895421 8.520000e-120 440
20 TraesCS2D01G591500 chr2D 98.165 218 4 0 2372 2589 647109631 647109848 5.240000e-102 381
21 TraesCS2D01G591500 chr2B 84.065 979 151 4 993 1969 788797155 788798130 0.000000e+00 939
22 TraesCS2D01G591500 chr3B 84.793 217 27 4 1984 2199 4347058 4347269 2.020000e-51 213


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G591500 chr2D 646850120 646852713 2593 False 4791.0 4791 100.0000 1 2594 1 chr2D.!!$F3 2593
1 TraesCS2D01G591500 chr2D 647000061 647002416 2355 False 4084.0 4084 97.9630 2 2355 1 chr2D.!!$F7 2353
2 TraesCS2D01G591500 chr2D 646948500 646950537 2037 False 3435.0 3435 97.0620 550 2591 1 chr2D.!!$F6 2041
3 TraesCS2D01G591500 chr2D 646916138 646918097 1959 False 3216.0 3216 96.1290 610 2594 1 chr2D.!!$F4 1984
4 TraesCS2D01G591500 chr2D 646970681 646973405 2724 False 2167.5 3851 97.0780 2 2591 2 chr2D.!!$F14 2589
5 TraesCS2D01G591500 chr2D 646808726 646811448 2722 False 2164.0 3838 97.2085 2 2591 2 chr2D.!!$F11 2589
6 TraesCS2D01G591500 chr2D 646632185 646633797 1612 True 2159.0 2159 90.8310 976 2594 1 chr2D.!!$R1 1618
7 TraesCS2D01G591500 chr2D 646870447 646872949 2502 False 2127.5 3398 97.6005 2 2591 2 chr2D.!!$F12 2589
8 TraesCS2D01G591500 chr2D 646892707 646895421 2714 False 2121.5 3803 95.6795 2 2591 2 chr2D.!!$F13 2589
9 TraesCS2D01G591500 chr2D 646786742 646789166 2424 False 2058.0 3127 97.2195 2 2591 2 chr2D.!!$F10 2589
10 TraesCS2D01G591500 chr2D 647101599 647102722 1123 False 1844.0 1844 96.2700 2 1126 1 chr2D.!!$F8 1124
11 TraesCS2D01G591500 chr2D 646765238 646766093 855 False 948.0 948 86.8090 553 1424 1 chr2D.!!$F1 871
12 TraesCS2D01G591500 chr2D 646736122 646736777 655 True 917.0 917 92.1570 2 649 1 chr2D.!!$R2 647
13 TraesCS2D01G591500 chr2D 646935515 646936069 554 False 913.0 913 96.3960 2 554 1 chr2D.!!$F5 552
14 TraesCS2D01G591500 chr2B 788797155 788798130 975 False 939.0 939 84.0650 993 1969 1 chr2B.!!$F1 976

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
951 990 0.546267 TCTTCCCTCTGCTGCTTCCT 60.546 55.0 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2464 2757 1.414866 TACACCACCAGCTTGCAGGA 61.415 55.0 10.99 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 235 1.016627 GCACTTTGACAGCAGACACA 58.983 50.000 0.00 0.00 0.00 3.72
273 276 6.540914 CCAGTAAGATTCCCGCATACTTTAAA 59.459 38.462 0.00 0.00 0.00 1.52
450 468 2.610833 TGCTTTCGCATATGCTCTTCTG 59.389 45.455 24.56 8.75 42.25 3.02
709 739 6.699642 CAGCTTTTCGAAAAGTTAATTTCCCA 59.300 34.615 37.54 10.40 45.48 4.37
712 742 8.556194 GCTTTTCGAAAAGTTAATTTCCCAATT 58.444 29.630 37.54 0.00 45.48 2.32
840 879 9.496873 TCATTCTGAATTTCTACCGAAGTTTTA 57.503 29.630 0.00 0.00 30.36 1.52
931 970 3.321648 AGCAGATCGCCACCACCA 61.322 61.111 6.02 0.00 44.04 4.17
951 990 0.546267 TCTTCCCTCTGCTGCTTCCT 60.546 55.000 0.00 0.00 0.00 3.36
1115 1154 3.525537 GCGAGATCATGTTCCTCAAAGA 58.474 45.455 0.00 0.00 0.00 2.52
1178 1217 1.599047 CTCCAATCGACCAGCCACT 59.401 57.895 0.00 0.00 0.00 4.00
1766 1833 9.909644 AATATGAAGCATATTTTCAAGAGCATC 57.090 29.630 6.80 0.00 42.26 3.91
1858 1925 6.409704 TCAGTGAGATAAGAACATTCCTTGG 58.590 40.000 0.00 0.00 0.00 3.61
1862 1929 8.112183 AGTGAGATAAGAACATTCCTTGGAAAT 58.888 33.333 6.16 0.00 0.00 2.17
2464 2757 3.951680 ACAACTCGGGTTCTTGATGTTTT 59.048 39.130 0.00 0.00 32.73 2.43
2497 2790 2.538449 GTGGTGTATATCGGCTGAAACG 59.462 50.000 0.00 0.00 0.00 3.60
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 4.471904 TCTTAGATGTGCCACGATTTCT 57.528 40.909 0.00 0.0 0.00 2.52
232 235 9.574516 AATCTTACTGGTTTGTCTGTTTCTAAT 57.425 29.630 0.00 0.0 0.00 1.73
450 468 4.878397 AGTTAACAAGCTACAGATCATGCC 59.122 41.667 8.61 0.0 0.00 4.40
840 879 5.426689 TGATTAGTCAGGAGCATGAAGTT 57.573 39.130 0.00 0.0 0.00 2.66
931 970 0.545646 GGAAGCAGCAGAGGGAAGAT 59.454 55.000 0.00 0.0 0.00 2.40
951 990 2.359354 CCGGCCGATGGTGTTTGA 60.359 61.111 30.73 0.0 0.00 2.69
1115 1154 1.039068 CTCCATGCTCTCCATCTCGT 58.961 55.000 0.00 0.0 29.71 4.18
1178 1217 2.886523 CAAAGCTTGACTTGGATGTCCA 59.113 45.455 0.00 0.0 45.94 4.02
1415 1454 6.599244 CACATTGTCAACCTTGTACCTATCAT 59.401 38.462 0.00 0.0 0.00 2.45
1539 1604 2.791560 CGTCAGCATCTTGATTACCTCG 59.208 50.000 0.00 0.0 0.00 4.63
1706 1773 1.007387 GGAAACAAAGGCCGCACAG 60.007 57.895 0.00 0.0 0.00 3.66
1766 1833 5.152623 TCTACTTGTCAAGTTGATGGAGG 57.847 43.478 22.81 0.0 42.81 4.30
1862 1929 8.836268 ACAAATATTCACAAACGTACCTCTTA 57.164 30.769 0.00 0.0 0.00 2.10
2464 2757 1.414866 TACACCACCAGCTTGCAGGA 61.415 55.000 10.99 0.0 0.00 3.86
2497 2790 4.360563 TCTTGAGTCGACAACAGAAAGAC 58.639 43.478 19.50 0.0 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.