Multiple sequence alignment - TraesCS2D01G591400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G591400 chr2D 100.000 2786 0 0 1 2786 646786579 646789364 0.000000e+00 5145
1 TraesCS2D01G591400 chr2D 98.283 2039 33 2 750 2786 646948698 646950736 0.000000e+00 3570
2 TraesCS2D01G591400 chr2D 97.354 2041 50 3 750 2786 646850869 646852909 0.000000e+00 3467
3 TraesCS2D01G591400 chr2D 95.933 2041 50 17 750 2786 646916282 646918293 0.000000e+00 3278
4 TraesCS2D01G591400 chr2D 97.447 1606 38 2 750 2352 647000811 647002416 0.000000e+00 2736
5 TraesCS2D01G591400 chr2D 97.285 1547 40 2 750 2295 646809472 646811017 0.000000e+00 2623
6 TraesCS2D01G591400 chr2D 97.156 1547 42 2 750 2295 646971429 646972974 0.000000e+00 2612
7 TraesCS2D01G591400 chr2D 96.639 1547 48 4 750 2295 646893453 646894996 0.000000e+00 2566
8 TraesCS2D01G591400 chr2D 91.538 1820 134 16 976 2786 646633797 646631989 0.000000e+00 2490
9 TraesCS2D01G591400 chr2D 98.270 1272 22 0 750 2021 646871191 646872462 0.000000e+00 2228
10 TraesCS2D01G591400 chr2D 97.463 749 19 0 1 749 646999898 647000646 0.000000e+00 1279
11 TraesCS2D01G591400 chr2D 97.463 749 18 1 1 749 646892545 646893292 0.000000e+00 1277
12 TraesCS2D01G591400 chr2D 97.330 749 20 0 1 749 646870284 646871032 0.000000e+00 1273
13 TraesCS2D01G591400 chr2D 97.330 749 20 0 1 749 646970518 646971266 0.000000e+00 1273
14 TraesCS2D01G591400 chr2D 97.196 749 21 0 1 749 646808563 646809311 0.000000e+00 1267
15 TraesCS2D01G591400 chr2D 97.063 749 22 0 1 749 646849958 646850706 0.000000e+00 1262
16 TraesCS2D01G591400 chr2D 96.770 743 24 0 1 743 647101436 647102178 0.000000e+00 1240
17 TraesCS2D01G591400 chr2D 98.551 690 8 2 2099 2786 646872459 646873148 0.000000e+00 1218
18 TraesCS2D01G591400 chr2D 96.657 718 21 2 1 716 646935353 646936069 0.000000e+00 1190
19 TraesCS2D01G591400 chr2D 93.325 764 30 4 1 749 646736940 646736183 0.000000e+00 1109
20 TraesCS2D01G591400 chr2D 97.345 565 15 0 1 565 646831590 646832154 0.000000e+00 961
21 TraesCS2D01G591400 chr2D 97.113 485 13 1 2303 2786 646811163 646811647 0.000000e+00 817
22 TraesCS2D01G591400 chr2D 96.701 485 15 1 2303 2786 646973120 646973604 0.000000e+00 806
23 TraesCS2D01G591400 chr2D 94.845 485 18 2 2303 2786 646895142 646895620 0.000000e+00 750
24 TraesCS2D01G591400 chr2D 97.852 419 8 1 2369 2786 647109631 647110049 0.000000e+00 723
25 TraesCS2D01G591400 chr2D 84.971 173 22 2 1993 2164 423276683 423276514 3.690000e-39 172


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G591400 chr2D 646786579 646789364 2785 False 5145.000000 5145 100.000000 1 2786 1 chr2D.!!$F1 2785
1 TraesCS2D01G591400 chr2D 646948698 646950736 2038 False 3570.000000 3570 98.283000 750 2786 1 chr2D.!!$F5 2036
2 TraesCS2D01G591400 chr2D 646916282 646918293 2011 False 3278.000000 3278 95.933000 750 2786 1 chr2D.!!$F3 2036
3 TraesCS2D01G591400 chr2D 646631989 646633797 1808 True 2490.000000 2490 91.538000 976 2786 1 chr2D.!!$R2 1810
4 TraesCS2D01G591400 chr2D 646849958 646852909 2951 False 2364.500000 3467 97.208500 1 2786 2 chr2D.!!$F9 2785
5 TraesCS2D01G591400 chr2D 646999898 647002416 2518 False 2007.500000 2736 97.455000 1 2352 2 chr2D.!!$F13 2351
6 TraesCS2D01G591400 chr2D 646870284 646873148 2864 False 1573.000000 2228 98.050333 1 2786 3 chr2D.!!$F10 2785
7 TraesCS2D01G591400 chr2D 646808563 646811647 3084 False 1569.000000 2623 97.198000 1 2786 3 chr2D.!!$F8 2785
8 TraesCS2D01G591400 chr2D 646970518 646973604 3086 False 1563.666667 2612 97.062333 1 2786 3 chr2D.!!$F12 2785
9 TraesCS2D01G591400 chr2D 646892545 646895620 3075 False 1531.000000 2566 96.315667 1 2786 3 chr2D.!!$F11 2785
10 TraesCS2D01G591400 chr2D 647101436 647102178 742 False 1240.000000 1240 96.770000 1 743 1 chr2D.!!$F6 742
11 TraesCS2D01G591400 chr2D 646935353 646936069 716 False 1190.000000 1190 96.657000 1 716 1 chr2D.!!$F4 715
12 TraesCS2D01G591400 chr2D 646736183 646736940 757 True 1109.000000 1109 93.325000 1 749 1 chr2D.!!$R3 748
13 TraesCS2D01G591400 chr2D 646831590 646832154 564 False 961.000000 961 97.345000 1 565 1 chr2D.!!$F2 564

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
424 428 0.768622 ACAAACCAGTCGGATTCCCA 59.231 50.0 0.00 0.0 35.59 4.37 F
1193 1378 0.253044 CCACCGGACATCCAAGTCAT 59.747 55.0 9.46 0.0 40.29 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1344 1529 3.855689 CCGATCTTGTGGCAAATCTTT 57.144 42.857 0.00 0.0 0.00 2.52 R
2485 2900 3.879892 GACAACAGAAAGAGGTTTCAGCT 59.120 43.478 1.03 0.0 44.08 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 216 4.406648 AATCGTGGCACATCTAAGATCA 57.593 40.909 19.09 0.0 44.52 2.92
235 237 6.515272 TCAGAAAATGCTCCTTTTGTATCC 57.485 37.500 0.00 0.0 0.00 2.59
315 319 8.510243 TCGGGTAAAAATAGGGTTAGAATTTC 57.490 34.615 0.00 0.0 0.00 2.17
424 428 0.768622 ACAAACCAGTCGGATTCCCA 59.231 50.000 0.00 0.0 35.59 4.37
680 699 7.201767 GCTGCTTCTTAATCATGTTTAGGATGT 60.202 37.037 16.30 0.0 0.00 3.06
743 762 7.987268 GTCATGTGACGACTATCTTGAAATA 57.013 36.000 0.00 0.0 35.12 1.40
763 948 8.366401 TGAAATAATTGCCTCAATTCAAGACAA 58.634 29.630 7.92 0.0 42.19 3.18
853 1038 3.365364 CGAAGTTTTGACTTCATGCTCCC 60.365 47.826 16.71 0.0 44.58 4.30
864 1049 4.141620 ACTTCATGCTCCCGACTAATCATT 60.142 41.667 0.00 0.0 0.00 2.57
1047 1232 2.124996 ACCCTCCTGCCCAAGCTA 59.875 61.111 0.00 0.0 40.80 3.32
1107 1292 0.911769 TCAGGGGCGAGATCATGTTT 59.088 50.000 0.00 0.0 0.00 2.83
1193 1378 0.253044 CCACCGGACATCCAAGTCAT 59.747 55.000 9.46 0.0 40.29 3.06
1344 1529 1.059584 TCAGCCTGTTGACCAAGGGA 61.060 55.000 0.00 0.0 0.00 4.20
1578 1767 1.195115 CGGAGGGAGATGAGGTTTCA 58.805 55.000 0.00 0.0 37.81 2.69
1591 1780 7.555087 AGATGAGGTTTCAGAGAAATGTCTAG 58.445 38.462 0.00 0.0 36.61 2.43
1686 1875 7.939782 TCAGAGTGCAAATCAGTATTCAAAAA 58.060 30.769 0.00 0.0 30.01 1.94
2021 2215 1.222567 GGTTGGGGGAGTGGATGTAT 58.777 55.000 0.00 0.0 0.00 2.29
2285 2561 8.792830 AAGCTTTATTACACAGCTCAATTCTA 57.207 30.769 0.00 0.0 43.28 2.10
2405 2819 8.345565 GTCTCGGAAAATATCAAGTATGCATTT 58.654 33.333 3.54 0.0 0.00 2.32
2485 2900 2.238395 TGCAAGCTGGTGGTGTATATCA 59.762 45.455 0.00 0.0 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 7.665559 AGTCTTGGTATCAGAAAAATACAGCAA 59.334 33.333 0.00 0.00 32.35 3.91
214 216 8.829373 ATTAGGATACAAAAGGAGCATTTTCT 57.171 30.769 0.00 0.00 41.41 2.52
315 319 2.404265 TGAAGCGCTCACACATTTTG 57.596 45.000 12.06 0.00 0.00 2.44
575 594 5.949735 CGAAAGCACCCAATTTACAGTATT 58.050 37.500 0.00 0.00 0.00 1.89
680 699 8.800370 TTACATATCATGCTGGAACTTAACAA 57.200 30.769 0.00 0.00 0.00 2.83
743 762 5.537674 AGACTTGTCTTGAATTGAGGCAATT 59.462 36.000 5.17 5.17 45.25 2.32
763 948 2.350863 AAGAAGTGGGGATGGAGACT 57.649 50.000 0.00 0.00 0.00 3.24
853 1038 4.600012 AGAACGGCAAAATGATTAGTCG 57.400 40.909 3.52 3.52 0.00 4.18
1047 1232 0.541863 CCTTGGTGATTAGGTCGGCT 59.458 55.000 0.00 0.00 0.00 5.52
1193 1378 2.918802 CAGCCTTGGCCCAAAGCA 60.919 61.111 18.86 0.00 46.50 3.91
1344 1529 3.855689 CCGATCTTGTGGCAAATCTTT 57.144 42.857 0.00 0.00 0.00 2.52
1578 1767 6.252995 AGAGACCACTTCTAGACATTTCTCT 58.747 40.000 11.64 11.64 33.22 3.10
1591 1780 6.127897 CCAAATCCAACAATAGAGACCACTTC 60.128 42.308 0.00 0.00 0.00 3.01
1686 1875 5.442402 GCACAATCGAATTGCAAATTTTGT 58.558 33.333 1.71 6.97 43.98 2.83
1852 2041 6.072618 TCACAAACGTACCTCTTGTTTTCAAA 60.073 34.615 0.00 0.00 39.47 2.69
2285 2561 9.920946 ATAAGAGTTGTCATACATTAATTGGGT 57.079 29.630 0.00 0.00 0.00 4.51
2405 2819 7.724506 ACTCTACTTCCGTATCCATTCTCAATA 59.275 37.037 0.00 0.00 0.00 1.90
2485 2900 3.879892 GACAACAGAAAGAGGTTTCAGCT 59.120 43.478 1.03 0.00 44.08 4.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.