Multiple sequence alignment - TraesCS2D01G588400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G588400 chr2D 100.000 2252 0 0 1 2252 645731936 645729685 0.000000e+00 4159.0
1 TraesCS2D01G588400 chr2D 93.333 195 13 0 1718 1912 645729034 645729228 2.830000e-74 289.0
2 TraesCS2D01G588400 chr2D 85.616 146 13 7 169 309 55253609 55253467 1.800000e-31 147.0
3 TraesCS2D01G588400 chr2D 82.677 127 17 4 183 306 55253296 55253172 8.500000e-20 108.0
4 TraesCS2D01G588400 chr2D 82.540 126 16 5 183 305 55252990 55252868 3.060000e-19 106.0
5 TraesCS2D01G588400 chr2D 79.739 153 23 6 164 311 610416514 610416663 1.100000e-18 104.0
6 TraesCS2D01G588400 chr2B 93.293 1640 43 29 48 1645 790224533 790226147 0.000000e+00 2357.0
7 TraesCS2D01G588400 chr2B 94.011 551 17 8 1718 2252 737766937 737766387 0.000000e+00 821.0
8 TraesCS2D01G588400 chr2B 93.466 551 20 9 1718 2252 737788836 737788286 0.000000e+00 804.0
9 TraesCS2D01G588400 chr2B 93.128 553 20 5 1716 2252 458252569 458252019 0.000000e+00 795.0
10 TraesCS2D01G588400 chr2B 97.403 77 2 0 1642 1718 790226584 790226660 5.050000e-27 132.0
11 TraesCS2D01G588400 chr2B 85.897 78 9 2 3 78 790225178 790225255 5.160000e-12 82.4
12 TraesCS2D01G588400 chr6D 84.734 1690 147 47 1 1644 421470037 421468413 0.000000e+00 1589.0
13 TraesCS2D01G588400 chr6D 84.515 1692 149 45 1 1644 38515029 38513403 0.000000e+00 1568.0
14 TraesCS2D01G588400 chr7D 83.953 1695 149 49 1 1644 94010785 94012407 0.000000e+00 1509.0
15 TraesCS2D01G588400 chr7D 79.856 417 47 14 375 761 558929348 558929757 1.030000e-68 270.0
16 TraesCS2D01G588400 chr2A 84.514 1369 108 44 1 1323 40008471 40007161 0.000000e+00 1258.0
17 TraesCS2D01G588400 chr2A 84.014 294 45 2 474 766 40008682 40008390 4.740000e-72 281.0
18 TraesCS2D01G588400 chr2A 88.816 152 17 0 1339 1490 39992561 39992410 1.060000e-43 187.0
19 TraesCS2D01G588400 chr3D 96.007 551 5 4 1718 2252 171127536 171126987 0.000000e+00 880.0
20 TraesCS2D01G588400 chr3D 92.424 198 15 0 1715 1912 171126333 171126530 1.320000e-72 283.0
21 TraesCS2D01G588400 chr4D 95.826 551 6 4 1718 2252 402523306 402523855 0.000000e+00 874.0
22 TraesCS2D01G588400 chr4D 93.434 198 13 0 1715 1912 402524509 402524312 6.080000e-76 294.0
23 TraesCS2D01G588400 chr5B 94.275 262 14 1 1718 1978 505155207 505155468 1.250000e-107 399.0
24 TraesCS2D01G588400 chr5B 94.595 37 1 1 403 439 19543633 19543598 3.120000e-04 56.5
25 TraesCS2D01G588400 chr3B 82.639 144 18 6 1132 1271 817464918 817465058 1.090000e-23 121.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G588400 chr2D 645729685 645731936 2251 True 4159.000000 4159 100.000000 1 2252 1 chr2D.!!$R1 2251
1 TraesCS2D01G588400 chr2B 790224533 790226660 2127 False 857.133333 2357 92.197667 3 1718 3 chr2B.!!$F1 1715
2 TraesCS2D01G588400 chr2B 737766387 737766937 550 True 821.000000 821 94.011000 1718 2252 1 chr2B.!!$R2 534
3 TraesCS2D01G588400 chr2B 737788286 737788836 550 True 804.000000 804 93.466000 1718 2252 1 chr2B.!!$R3 534
4 TraesCS2D01G588400 chr2B 458252019 458252569 550 True 795.000000 795 93.128000 1716 2252 1 chr2B.!!$R1 536
5 TraesCS2D01G588400 chr6D 421468413 421470037 1624 True 1589.000000 1589 84.734000 1 1644 1 chr6D.!!$R2 1643
6 TraesCS2D01G588400 chr6D 38513403 38515029 1626 True 1568.000000 1568 84.515000 1 1644 1 chr6D.!!$R1 1643
7 TraesCS2D01G588400 chr7D 94010785 94012407 1622 False 1509.000000 1509 83.953000 1 1644 1 chr7D.!!$F1 1643
8 TraesCS2D01G588400 chr2A 40007161 40008682 1521 True 769.500000 1258 84.264000 1 1323 2 chr2A.!!$R2 1322
9 TraesCS2D01G588400 chr3D 171126987 171127536 549 True 880.000000 880 96.007000 1718 2252 1 chr3D.!!$R1 534
10 TraesCS2D01G588400 chr4D 402523306 402523855 549 False 874.000000 874 95.826000 1718 2252 1 chr4D.!!$F1 534

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
46 262 0.799534 GATTGCCATGTTCTGCGCAC 60.8 55.0 5.66 0.0 32.85 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1533 1844 0.107508 CACTGACCCAGCCCACATAG 60.108 60.0 0.0 0.0 34.37 2.23 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 252 5.291971 AGTTGTTTGAAGATTGCCATGTTC 58.708 37.500 1.05 1.05 33.99 3.18
43 256 1.469703 TGAAGATTGCCATGTTCTGCG 59.530 47.619 8.81 0.00 34.41 5.18
46 262 0.799534 GATTGCCATGTTCTGCGCAC 60.800 55.000 5.66 0.00 32.85 5.34
600 838 2.415512 GTCGTACTCAATTTGCCACCTC 59.584 50.000 0.00 0.00 0.00 3.85
793 1031 7.215789 CACCTAAAATAGCTCTGTCATCATCT 58.784 38.462 0.00 0.00 0.00 2.90
837 1075 4.119442 TCGTCTGCACCTAAAATAGACC 57.881 45.455 0.00 0.00 35.52 3.85
898 1143 2.565841 GCCTAACATAGCCCTTCACAG 58.434 52.381 0.00 0.00 0.00 3.66
1211 1472 1.133407 GCTTGAGAAGACGACGAGGAT 59.867 52.381 0.00 0.00 0.00 3.24
1226 1487 2.594541 GGATGATTCCGTCGCTCAC 58.405 57.895 0.00 0.00 30.72 3.51
1497 1808 2.655364 CCGGCGAGTATGACAGCG 60.655 66.667 9.30 0.00 0.00 5.18
1581 1894 5.426509 TGAGATGAAAGGATAAGCAGAGGAA 59.573 40.000 0.00 0.00 0.00 3.36
1582 1895 5.679601 AGATGAAAGGATAAGCAGAGGAAC 58.320 41.667 0.00 0.00 0.00 3.62
1689 2442 2.283604 TGCACTCGGCCTCCACTA 60.284 61.111 0.00 0.00 43.89 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 219 7.277760 GGCAATCTTCAAACAACTTTTTGTAGT 59.722 33.333 0.00 0.00 45.69 2.73
12 224 6.598850 ACATGGCAATCTTCAAACAACTTTTT 59.401 30.769 0.00 0.00 0.00 1.94
26 238 0.961857 TGCGCAGAACATGGCAATCT 60.962 50.000 5.66 0.00 33.77 2.40
27 239 0.799534 GTGCGCAGAACATGGCAATC 60.800 55.000 12.22 0.00 37.01 2.67
39 252 2.054687 ACATGACATTTTGTGCGCAG 57.945 45.000 12.22 0.00 0.00 5.18
43 256 6.000891 TGAGTAGAACATGACATTTTGTGC 57.999 37.500 0.00 0.00 0.00 4.57
136 359 7.951347 ATAGCCTGATCCATTAAATGAATCC 57.049 36.000 0.00 0.00 0.00 3.01
242 465 6.121590 AGTTTGCCACCATTTTCTTCAAATT 58.878 32.000 0.00 0.00 32.24 1.82
401 637 6.788218 TGGTCCATGTGATATATTTGCCATA 58.212 36.000 0.00 0.00 0.00 2.74
600 838 8.344098 ACATGGCAATTTTGTTAAAAATGTCAG 58.656 29.630 12.88 8.79 43.63 3.51
684 922 6.366877 TCGGACAACTTTTAGTAGATTTTCCG 59.633 38.462 4.01 4.01 41.92 4.30
738 976 6.209192 TGATGGCAAATTTGAGTAGAACATGT 59.791 34.615 22.31 0.00 0.00 3.21
793 1031 1.340600 ACAGGGCTATTTTTAGGCGCA 60.341 47.619 10.83 0.00 42.80 6.09
1316 1621 1.739667 CCATCATAGTCCGCCGTCA 59.260 57.895 0.00 0.00 0.00 4.35
1328 1633 2.202932 GCTGACCGACGCCATCAT 60.203 61.111 0.00 0.00 0.00 2.45
1329 1634 3.356639 GAGCTGACCGACGCCATCA 62.357 63.158 0.00 0.00 0.00 3.07
1479 1790 2.494918 GCTGTCATACTCGCCGGT 59.505 61.111 1.90 0.00 0.00 5.28
1533 1844 0.107508 CACTGACCCAGCCCACATAG 60.108 60.000 0.00 0.00 34.37 2.23
1689 2442 3.778265 ACATGGCAATGGTAGGTTTCTT 58.222 40.909 5.94 0.00 38.19 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.