Multiple sequence alignment - TraesCS2D01G586400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G586400 chr2D 100.000 2618 0 0 1 2618 644817770 644820387 0 4835
1 TraesCS2D01G586400 chr1D 98.396 2619 38 3 1 2618 187808476 187811091 0 4601
2 TraesCS2D01G586400 chr7D 98.320 2619 40 3 1 2618 29571717 29569102 0 4590
3 TraesCS2D01G586400 chr5A 98.245 2621 43 2 1 2618 139476835 139474215 0 4582
4 TraesCS2D01G586400 chr4D 98.207 2622 41 4 1 2618 403009000 403011619 0 4577
5 TraesCS2D01G586400 chr4B 95.669 2632 96 8 1 2618 74348789 74351416 0 4213
6 TraesCS2D01G586400 chr2B 95.363 2286 97 4 342 2618 63131876 63129591 0 3626
7 TraesCS2D01G586400 chr3D 95.976 2038 74 6 584 2618 107214418 107216450 0 3302
8 TraesCS2D01G586400 chr3D 95.601 591 21 4 1 588 107205664 107206252 0 942
9 TraesCS2D01G586400 chr6D 92.750 1807 85 16 1 1780 433250904 433252691 0 2569
10 TraesCS2D01G586400 chr6A 97.947 1364 21 4 1 1359 615073841 615072480 0 2357
11 TraesCS2D01G586400 chr6A 98.480 987 14 1 1632 2618 615072488 615071503 0 1738
12 TraesCS2D01G586400 chr2A 92.645 1618 82 13 181 1780 605004802 605003204 0 2294
13 TraesCS2D01G586400 chr7B 96.022 1257 49 1 1362 2618 400417620 400416365 0 2043
14 TraesCS2D01G586400 chr6B 95.265 528 22 2 1 526 128934556 128934030 0 833


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G586400 chr2D 644817770 644820387 2617 False 4835.0 4835 100.0000 1 2618 1 chr2D.!!$F1 2617
1 TraesCS2D01G586400 chr1D 187808476 187811091 2615 False 4601.0 4601 98.3960 1 2618 1 chr1D.!!$F1 2617
2 TraesCS2D01G586400 chr7D 29569102 29571717 2615 True 4590.0 4590 98.3200 1 2618 1 chr7D.!!$R1 2617
3 TraesCS2D01G586400 chr5A 139474215 139476835 2620 True 4582.0 4582 98.2450 1 2618 1 chr5A.!!$R1 2617
4 TraesCS2D01G586400 chr4D 403009000 403011619 2619 False 4577.0 4577 98.2070 1 2618 1 chr4D.!!$F1 2617
5 TraesCS2D01G586400 chr4B 74348789 74351416 2627 False 4213.0 4213 95.6690 1 2618 1 chr4B.!!$F1 2617
6 TraesCS2D01G586400 chr2B 63129591 63131876 2285 True 3626.0 3626 95.3630 342 2618 1 chr2B.!!$R1 2276
7 TraesCS2D01G586400 chr3D 107214418 107216450 2032 False 3302.0 3302 95.9760 584 2618 1 chr3D.!!$F2 2034
8 TraesCS2D01G586400 chr3D 107205664 107206252 588 False 942.0 942 95.6010 1 588 1 chr3D.!!$F1 587
9 TraesCS2D01G586400 chr6D 433250904 433252691 1787 False 2569.0 2569 92.7500 1 1780 1 chr6D.!!$F1 1779
10 TraesCS2D01G586400 chr6A 615071503 615073841 2338 True 2047.5 2357 98.2135 1 2618 2 chr6A.!!$R1 2617
11 TraesCS2D01G586400 chr2A 605003204 605004802 1598 True 2294.0 2294 92.6450 181 1780 1 chr2A.!!$R1 1599
12 TraesCS2D01G586400 chr7B 400416365 400417620 1255 True 2043.0 2043 96.0220 1362 2618 1 chr7B.!!$R1 1256
13 TraesCS2D01G586400 chr6B 128934030 128934556 526 True 833.0 833 95.2650 1 526 1 chr6B.!!$R1 525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
99 104 2.448708 AGATCAGATAGGGAGGGGAGT 58.551 52.381 0.0 0.0 0.0 3.85 F
1171 1208 1.032794 TCTCACGCACAAGTCTCAGT 58.967 50.000 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1442 1486 0.612174 AGCTCAGTCACGAAGCCCTA 60.612 55.0 1.24 0.0 0.0 3.53 R
2579 2647 0.320683 CACCTTCATGCGTGGACTGA 60.321 55.0 5.98 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 104 2.448708 AGATCAGATAGGGAGGGGAGT 58.551 52.381 0.0 0.0 0.00 3.85
398 408 6.257630 ACAATTTTGTTTATGTTGTGAGTGGC 59.742 34.615 0.0 0.0 38.47 5.01
1171 1208 1.032794 TCTCACGCACAAGTCTCAGT 58.967 50.000 0.0 0.0 0.00 3.41
1442 1486 8.811017 TGTAATACAAAATGAAACATGGTGGAT 58.189 29.630 0.0 0.0 0.00 3.41
1635 1695 1.202521 TGAATGGTATGTGCGCGATCT 60.203 47.619 12.1 0.0 0.00 2.75
2443 2511 6.036735 TGCTATTTCTATCCACACGTAAAAGC 59.963 38.462 0.0 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
398 408 1.880027 GCCAGCGGTAAGGAATATTGG 59.120 52.381 0.00 0.0 0.00 3.16
1171 1208 1.557099 ATAGCTGTCGTTGTCTCCCA 58.443 50.000 0.00 0.0 0.00 4.37
1442 1486 0.612174 AGCTCAGTCACGAAGCCCTA 60.612 55.000 1.24 0.0 0.00 3.53
2443 2511 8.559536 AGCAAATTAATTGTGGATACGTAGATG 58.440 33.333 0.39 0.0 41.32 2.90
2579 2647 0.320683 CACCTTCATGCGTGGACTGA 60.321 55.000 5.98 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.