Multiple sequence alignment - TraesCS2D01G585800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G585800 chr2D 100.000 3170 0 0 1 3170 644638012 644634843 0.000000e+00 5854
1 TraesCS2D01G585800 chr2D 98.782 2217 9 3 972 3170 587650011 587647795 0.000000e+00 3928
2 TraesCS2D01G585800 chr2D 99.117 566 4 1 1 565 587651038 587650473 0.000000e+00 1016
3 TraesCS2D01G585800 chr2D 98.837 344 4 0 600 943 587650351 587650008 5.810000e-172 614
4 TraesCS2D01G585800 chr2B 87.869 1558 102 44 1449 2991 710101502 710100017 0.000000e+00 1749
5 TraesCS2D01G585800 chr2B 93.576 934 31 13 1685 2613 710045817 710044908 0.000000e+00 1365
6 TraesCS2D01G585800 chr2B 90.909 605 30 11 977 1560 710046521 710045921 0.000000e+00 789
7 TraesCS2D01G585800 chr2B 83.513 837 85 29 600 1406 710102277 710101464 0.000000e+00 732
8 TraesCS2D01G585800 chr2B 86.157 549 43 18 5 545 710102913 710102390 2.130000e-156 562
9 TraesCS2D01G585800 chr2B 86.957 368 22 14 600 945 710046885 710046522 1.070000e-104 390
10 TraesCS2D01G585800 chr2B 94.554 202 11 0 2611 2812 710044781 710044580 2.370000e-81 313
11 TraesCS2D01G585800 chr2B 95.041 121 4 2 2813 2931 710042726 710042606 4.170000e-44 189
12 TraesCS2D01G585800 chr2B 89.535 86 3 3 2960 3044 710042611 710042531 1.560000e-18 104
13 TraesCS2D01G585800 chr2B 95.161 62 3 0 3109 3170 710042468 710042407 7.240000e-17 99
14 TraesCS2D01G585800 chr2A 85.593 1180 69 39 1449 2605 722320831 722319730 0.000000e+00 1144
15 TraesCS2D01G585800 chr2A 84.759 912 88 23 600 1487 722321605 722320721 0.000000e+00 867
16 TraesCS2D01G585800 chr2A 79.487 351 14 16 1 324 722492082 722491763 2.490000e-46 196
17 TraesCS2D01G585800 chr2A 85.350 157 12 4 2898 3044 722319349 722319194 5.480000e-33 152
18 TraesCS2D01G585800 chr6B 87.766 376 31 10 1580 1951 153228714 153229078 2.920000e-115 425
19 TraesCS2D01G585800 chr6B 84.892 139 9 5 1985 2122 153229034 153229161 2.570000e-26 130


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G585800 chr2D 644634843 644638012 3169 True 5854.000000 5854 100.000000 1 3170 1 chr2D.!!$R1 3169
1 TraesCS2D01G585800 chr2D 587647795 587651038 3243 True 1852.666667 3928 98.912000 1 3170 3 chr2D.!!$R2 3169
2 TraesCS2D01G585800 chr2B 710100017 710102913 2896 True 1014.333333 1749 85.846333 5 2991 3 chr2B.!!$R2 2986
3 TraesCS2D01G585800 chr2B 710042407 710046885 4478 True 464.142857 1365 92.247571 600 3170 7 chr2B.!!$R1 2570
4 TraesCS2D01G585800 chr2A 722319194 722321605 2411 True 721.000000 1144 85.234000 600 3044 3 chr2A.!!$R2 2444

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
801 934 2.112297 AGCGGCCGGAAGAAAACA 59.888 55.556 29.38 0.0 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2923 5286 1.725641 TGCTATCCGCACTGAACAAG 58.274 50.0 0.0 0.0 45.47 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
801 934 2.112297 AGCGGCCGGAAGAAAACA 59.888 55.556 29.38 0.00 0.00 2.83
944 1083 7.780064 TCACAATCTGATTTCAAAAACTTCCA 58.220 30.769 0.00 0.00 0.00 3.53
1592 1897 4.060038 ACTTATACGATCCTGCTGTTGG 57.940 45.455 0.00 0.00 0.00 3.77
2109 2443 0.532862 ATATTTCCGGTGCTGCCTCG 60.533 55.000 0.00 0.61 34.25 4.63
2923 5286 0.955428 TCAATCGTCCAGGCTTGTGC 60.955 55.000 0.00 0.00 38.76 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
591 627 8.475639 GTTTCTATGGAGGTTTCTGAGTACATA 58.524 37.037 0.0 0.0 0.00 2.29
592 628 7.038302 TGTTTCTATGGAGGTTTCTGAGTACAT 60.038 37.037 0.0 0.0 0.00 2.29
593 629 6.269077 TGTTTCTATGGAGGTTTCTGAGTACA 59.731 38.462 0.0 0.0 0.00 2.90
595 631 6.571731 CGTGTTTCTATGGAGGTTTCTGAGTA 60.572 42.308 0.0 0.0 0.00 2.59
597 633 4.627467 CGTGTTTCTATGGAGGTTTCTGAG 59.373 45.833 0.0 0.0 0.00 3.35
598 634 4.566004 CGTGTTTCTATGGAGGTTTCTGA 58.434 43.478 0.0 0.0 0.00 3.27
2923 5286 1.725641 TGCTATCCGCACTGAACAAG 58.274 50.000 0.0 0.0 45.47 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.