Multiple sequence alignment - TraesCS2D01G581700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G581700 chr2D 100.000 3558 0 0 1 3558 643049668 643053225 0.000000e+00 6571.0
1 TraesCS2D01G581700 chr2D 95.468 1037 18 3 2551 3558 648110770 648109734 0.000000e+00 1628.0
2 TraesCS2D01G581700 chr2D 91.031 524 45 1 1 524 643173432 643173953 0.000000e+00 706.0
3 TraesCS2D01G581700 chr2D 90.283 494 39 2 1 494 643119795 643120279 3.870000e-179 638.0
4 TraesCS2D01G581700 chr2D 87.977 524 55 3 1 524 643142168 643142683 2.350000e-171 612.0
5 TraesCS2D01G581700 chr2D 86.140 570 49 19 2553 3116 47287743 47288288 3.960000e-164 588.0
6 TraesCS2D01G581700 chr2D 99.492 197 1 0 2553 2749 643058659 643058463 3.380000e-95 359.0
7 TraesCS2D01G581700 chr2D 98.039 204 3 1 2550 2752 648104298 648104501 1.570000e-93 353.0
8 TraesCS2D01G581700 chr6D 99.530 2552 12 0 1 2552 29468121 29465570 0.000000e+00 4647.0
9 TraesCS2D01G581700 chr6D 94.851 505 14 3 2550 3042 113904167 113904671 0.000000e+00 778.0
10 TraesCS2D01G581700 chr6D 97.778 45 1 0 744 788 10765737 10765781 1.060000e-10 78.7
11 TraesCS2D01G581700 chr5D 95.284 1039 14 10 2553 3558 367799727 367800763 0.000000e+00 1615.0
12 TraesCS2D01G581700 chr5D 97.368 38 1 0 1835 1872 74419558 74419595 8.240000e-07 65.8
13 TraesCS2D01G581700 chr7D 94.071 1012 34 5 2553 3555 214764742 214765736 0.000000e+00 1513.0
14 TraesCS2D01G581700 chr7D 92.940 1034 48 8 2548 3558 465836230 465835199 0.000000e+00 1482.0
15 TraesCS2D01G581700 chr7D 98.467 261 3 1 2550 2809 219288438 219288698 3.240000e-125 459.0
16 TraesCS2D01G581700 chr7D 97.619 42 1 0 747 788 462673295 462673254 4.930000e-09 73.1
17 TraesCS2D01G581700 chr3D 92.471 1036 40 8 2545 3558 460901756 460900737 0.000000e+00 1447.0
18 TraesCS2D01G581700 chr2A 89.105 1028 63 14 2553 3555 84206501 84207504 0.000000e+00 1232.0
19 TraesCS2D01G581700 chr2A 93.767 754 33 3 2819 3558 766619140 766618387 0.000000e+00 1120.0
20 TraesCS2D01G581700 chr2A 93.090 521 34 1 1 521 768037311 768037829 0.000000e+00 761.0
21 TraesCS2D01G581700 chr7B 86.961 1043 77 17 2553 3551 455230276 455231303 0.000000e+00 1118.0
22 TraesCS2D01G581700 chr7B 97.619 42 1 0 747 788 485833154 485833113 4.930000e-09 73.1
23 TraesCS2D01G581700 chr1A 85.160 1031 102 26 2552 3555 330088632 330089638 0.000000e+00 1009.0
24 TraesCS2D01G581700 chr2B 88.822 832 59 9 2756 3555 1903829 1904658 0.000000e+00 990.0
25 TraesCS2D01G581700 chr2B 90.909 55 3 2 747 801 101515944 101515996 4.930000e-09 73.1
26 TraesCS2D01G581700 chr4A 88.690 725 55 10 2846 3555 485007460 485008172 0.000000e+00 859.0
27 TraesCS2D01G581700 chrUn 92.748 524 36 1 1 524 31642372 31642893 0.000000e+00 756.0
28 TraesCS2D01G581700 chr5B 83.602 683 82 15 2879 3549 538553623 538554287 6.530000e-172 614.0
29 TraesCS2D01G581700 chr3A 85.166 573 63 13 2553 3116 487474701 487474142 5.150000e-158 568.0
30 TraesCS2D01G581700 chr6B 97.674 43 1 0 746 788 20360128 20360170 1.370000e-09 75.0
31 TraesCS2D01G581700 chr1D 97.674 43 1 0 746 788 142656886 142656844 1.370000e-09 75.0
32 TraesCS2D01G581700 chr1B 97.674 43 1 0 747 789 626147099 626147141 1.370000e-09 75.0
33 TraesCS2D01G581700 chr6A 97.619 42 1 0 747 788 498950132 498950173 4.930000e-09 73.1
34 TraesCS2D01G581700 chr5A 97.368 38 1 0 1835 1872 69546086 69546123 8.240000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G581700 chr2D 643049668 643053225 3557 False 6571 6571 100.000 1 3558 1 chr2D.!!$F2 3557
1 TraesCS2D01G581700 chr2D 648109734 648110770 1036 True 1628 1628 95.468 2551 3558 1 chr2D.!!$R2 1007
2 TraesCS2D01G581700 chr2D 643173432 643173953 521 False 706 706 91.031 1 524 1 chr2D.!!$F5 523
3 TraesCS2D01G581700 chr2D 643142168 643142683 515 False 612 612 87.977 1 524 1 chr2D.!!$F4 523
4 TraesCS2D01G581700 chr2D 47287743 47288288 545 False 588 588 86.140 2553 3116 1 chr2D.!!$F1 563
5 TraesCS2D01G581700 chr6D 29465570 29468121 2551 True 4647 4647 99.530 1 2552 1 chr6D.!!$R1 2551
6 TraesCS2D01G581700 chr6D 113904167 113904671 504 False 778 778 94.851 2550 3042 1 chr6D.!!$F2 492
7 TraesCS2D01G581700 chr5D 367799727 367800763 1036 False 1615 1615 95.284 2553 3558 1 chr5D.!!$F2 1005
8 TraesCS2D01G581700 chr7D 214764742 214765736 994 False 1513 1513 94.071 2553 3555 1 chr7D.!!$F1 1002
9 TraesCS2D01G581700 chr7D 465835199 465836230 1031 True 1482 1482 92.940 2548 3558 1 chr7D.!!$R2 1010
10 TraesCS2D01G581700 chr3D 460900737 460901756 1019 True 1447 1447 92.471 2545 3558 1 chr3D.!!$R1 1013
11 TraesCS2D01G581700 chr2A 84206501 84207504 1003 False 1232 1232 89.105 2553 3555 1 chr2A.!!$F1 1002
12 TraesCS2D01G581700 chr2A 766618387 766619140 753 True 1120 1120 93.767 2819 3558 1 chr2A.!!$R1 739
13 TraesCS2D01G581700 chr2A 768037311 768037829 518 False 761 761 93.090 1 521 1 chr2A.!!$F2 520
14 TraesCS2D01G581700 chr7B 455230276 455231303 1027 False 1118 1118 86.961 2553 3551 1 chr7B.!!$F1 998
15 TraesCS2D01G581700 chr1A 330088632 330089638 1006 False 1009 1009 85.160 2552 3555 1 chr1A.!!$F1 1003
16 TraesCS2D01G581700 chr2B 1903829 1904658 829 False 990 990 88.822 2756 3555 1 chr2B.!!$F1 799
17 TraesCS2D01G581700 chr4A 485007460 485008172 712 False 859 859 88.690 2846 3555 1 chr4A.!!$F1 709
18 TraesCS2D01G581700 chrUn 31642372 31642893 521 False 756 756 92.748 1 524 1 chrUn.!!$F1 523
19 TraesCS2D01G581700 chr5B 538553623 538554287 664 False 614 614 83.602 2879 3549 1 chr5B.!!$F1 670
20 TraesCS2D01G581700 chr3A 487474142 487474701 559 True 568 568 85.166 2553 3116 1 chr3A.!!$R1 563

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
954 955 1.067212 CCGATAAACTAGCAGCCGTCT 59.933 52.381 0.0 0.0 0.00 4.18 F
2385 2386 0.103208 GGGAGCAAGATCGACGTGAT 59.897 55.000 0.0 0.0 41.06 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2526 2527 0.747283 CTCCATGTTGAGCTGCTCCC 60.747 60.0 25.61 16.64 0.0 4.3 R
3287 3426 2.856760 TCCCTCTTATCCTCTGCAGT 57.143 50.0 14.67 0.00 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
954 955 1.067212 CCGATAAACTAGCAGCCGTCT 59.933 52.381 0.0 0.0 0.00 4.18
1962 1963 5.193728 TCTTCCTTATTTCCAGCCAGGTTAT 59.806 40.000 0.0 0.0 39.02 1.89
2385 2386 0.103208 GGGAGCAAGATCGACGTGAT 59.897 55.000 0.0 0.0 41.06 3.06
2391 2392 1.330655 AAGATCGACGTGATGGGGCT 61.331 55.000 0.0 0.0 37.47 5.19
2502 2503 0.445436 CTTCTGCATGGCTTCACGTC 59.555 55.000 0.0 0.0 0.00 4.34
2526 2527 2.738521 CCCTGACGGCACAACGAG 60.739 66.667 0.0 0.0 37.61 4.18
2533 2534 2.743928 GGCACAACGAGGGAGCAG 60.744 66.667 0.0 0.0 0.00 4.24
3287 3426 3.133901 TGAAGCCGTAGATGCATTAGGAA 59.866 43.478 0.0 0.0 0.00 3.36
3388 3536 4.337836 GGCTTTGAAGATGGAAGAAGATCC 59.662 45.833 0.0 0.0 40.10 3.36
3524 3672 3.118112 AGTGCTGCTAGGCATTTCTATGT 60.118 43.478 0.0 0.0 44.34 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 219 4.101448 ACATGAGCCAGCCGACCC 62.101 66.667 0.00 0.00 0.00 4.46
954 955 2.254546 ACTTGCAAGGTTGATGACGA 57.745 45.000 29.18 0.00 0.00 4.20
1962 1963 5.413499 TCCTGATCGACGATCGTGTATATA 58.587 41.667 28.12 10.79 41.51 0.86
2385 2386 3.731728 GCTCCATGTCCAGCCCCA 61.732 66.667 0.00 0.00 0.00 4.96
2391 2392 1.907739 GGTAGCAGCTCCATGTCCA 59.092 57.895 0.00 0.00 0.00 4.02
2526 2527 0.747283 CTCCATGTTGAGCTGCTCCC 60.747 60.000 25.61 16.64 0.00 4.30
2533 2534 3.640967 ACTCTATCTCCTCCATGTTGAGC 59.359 47.826 0.00 0.00 0.00 4.26
3153 3292 1.667724 GACGCCAGAAATCACCATCAG 59.332 52.381 0.00 0.00 0.00 2.90
3287 3426 2.856760 TCCCTCTTATCCTCTGCAGT 57.143 50.000 14.67 0.00 0.00 4.40
3524 3672 4.456911 GCATCAACTCCATCACTTCTTCAA 59.543 41.667 0.00 0.00 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.