Multiple sequence alignment - TraesCS2D01G581600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G581600 chr2D 100.000 3092 0 0 1 3092 643047869 643050960 0.000000e+00 5710.0
1 TraesCS2D01G581600 chr2D 85.207 2366 284 45 1 2323 643171611 643173953 0.000000e+00 2370.0
2 TraesCS2D01G581600 chr2D 87.833 1578 168 9 717 2293 643118725 643120279 0.000000e+00 1829.0
3 TraesCS2D01G581600 chr2D 85.684 1404 145 27 1 1363 643131684 643133072 0.000000e+00 1428.0
4 TraesCS2D01G581600 chr2D 87.372 681 78 3 1643 2323 643142011 643142683 0.000000e+00 774.0
5 TraesCS2D01G581600 chr2D 87.267 322 38 2 319 639 643110004 643110323 6.300000e-97 364.0
6 TraesCS2D01G581600 chr2D 92.361 144 11 0 1505 1648 643133175 643133318 4.040000e-49 206.0
7 TraesCS2D01G581600 chr6D 99.191 3092 21 1 1 3092 29469916 29466829 0.000000e+00 5568.0
8 TraesCS2D01G581600 chr6D 97.778 45 1 0 2543 2587 10765737 10765781 9.190000e-11 78.7
9 TraesCS2D01G581600 chr2A 85.949 2256 243 40 118 2320 768035595 768037829 0.000000e+00 2342.0
10 TraesCS2D01G581600 chr2A 73.482 626 118 25 768 1362 2902935 2903543 3.150000e-45 193.0
11 TraesCS2D01G581600 chrUn 85.969 1404 140 26 1 1363 31640587 31641974 0.000000e+00 1448.0
12 TraesCS2D01G581600 chrUn 91.453 819 68 1 1505 2323 31642077 31642893 0.000000e+00 1123.0
13 TraesCS2D01G581600 chrUn 78.017 232 41 6 769 994 212988118 212988345 1.500000e-28 137.0
14 TraesCS2D01G581600 chrUn 78.017 232 41 6 769 994 224598866 224599093 1.500000e-28 137.0
15 TraesCS2D01G581600 chr6B 97.674 43 1 0 2545 2587 20360128 20360170 1.190000e-09 75.0
16 TraesCS2D01G581600 chr1D 97.674 43 1 0 2545 2587 142656886 142656844 1.190000e-09 75.0
17 TraesCS2D01G581600 chr1B 97.674 43 1 0 2546 2588 626147099 626147141 1.190000e-09 75.0
18 TraesCS2D01G581600 chr7D 97.619 42 1 0 2546 2587 462673295 462673254 4.280000e-09 73.1
19 TraesCS2D01G581600 chr7B 97.619 42 1 0 2546 2587 485833154 485833113 4.280000e-09 73.1
20 TraesCS2D01G581600 chr6A 97.619 42 1 0 2546 2587 498950132 498950173 4.280000e-09 73.1
21 TraesCS2D01G581600 chr2B 90.909 55 3 2 2546 2600 101515944 101515996 4.280000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G581600 chr2D 643047869 643050960 3091 False 5710.0 5710 100.0000 1 3092 1 chr2D.!!$F1 3091
1 TraesCS2D01G581600 chr2D 643171611 643173953 2342 False 2370.0 2370 85.2070 1 2323 1 chr2D.!!$F5 2322
2 TraesCS2D01G581600 chr2D 643118725 643120279 1554 False 1829.0 1829 87.8330 717 2293 1 chr2D.!!$F3 1576
3 TraesCS2D01G581600 chr2D 643131684 643133318 1634 False 817.0 1428 89.0225 1 1648 2 chr2D.!!$F6 1647
4 TraesCS2D01G581600 chr2D 643142011 643142683 672 False 774.0 774 87.3720 1643 2323 1 chr2D.!!$F4 680
5 TraesCS2D01G581600 chr6D 29466829 29469916 3087 True 5568.0 5568 99.1910 1 3092 1 chr6D.!!$R1 3091
6 TraesCS2D01G581600 chr2A 768035595 768037829 2234 False 2342.0 2342 85.9490 118 2320 1 chr2A.!!$F2 2202
7 TraesCS2D01G581600 chrUn 31640587 31642893 2306 False 1285.5 1448 88.7110 1 2323 2 chrUn.!!$F3 2322

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
367 392 1.956170 CGCTATCGCCACCATCCAC 60.956 63.158 0.00 0.0 0.00 4.02 F
1032 1085 2.375174 AGGTGGCTTAGTGACCATTGAA 59.625 45.455 4.96 0.0 38.46 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2017 2079 4.101448 ACATGAGCCAGCCGACCC 62.101 66.667 0.00 0.0 0.0 4.46 R
2753 2815 2.254546 ACTTGCAAGGTTGATGACGA 57.745 45.000 29.18 0.0 0.0 4.20 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 169 8.539770 TCTTGACTGAATCAGACATCTTAAAC 57.460 34.615 18.20 0.0 38.99 2.01
367 392 1.956170 CGCTATCGCCACCATCCAC 60.956 63.158 0.00 0.0 0.00 4.02
780 826 3.011708 AGGTTATCCCACCATTTGCTCTT 59.988 43.478 0.00 0.0 39.62 2.85
840 886 4.088634 ACAAGGCCAGAAAATCATTAGCA 58.911 39.130 5.01 0.0 0.00 3.49
841 887 4.527816 ACAAGGCCAGAAAATCATTAGCAA 59.472 37.500 5.01 0.0 0.00 3.91
842 888 5.188359 ACAAGGCCAGAAAATCATTAGCAAT 59.812 36.000 5.01 0.0 0.00 3.56
843 889 5.945144 AGGCCAGAAAATCATTAGCAATT 57.055 34.783 5.01 0.0 0.00 2.32
1032 1085 2.375174 AGGTGGCTTAGTGACCATTGAA 59.625 45.455 4.96 0.0 38.46 2.69
2753 2815 1.067212 CCGATAAACTAGCAGCCGTCT 59.933 52.381 0.00 0.0 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 2.423185 TGCAACAAAGTCTGGTGAACTG 59.577 45.455 0.00 0.0 46.67 3.16
166 169 3.317150 TCGACATGAGTTGCTAACACAG 58.683 45.455 0.00 0.0 35.50 3.66
367 392 3.458189 CCAAGAAGATGTAGCGGGTTAG 58.542 50.000 0.00 0.0 0.00 2.34
780 826 6.777213 TTGAAAAGTAACTTGGCAAAGGTA 57.223 33.333 5.66 0.0 37.76 3.08
1032 1085 2.036346 GTCATCCAGCTGCCAAACTTTT 59.964 45.455 8.66 0.0 0.00 2.27
1282 1335 9.286170 CATCCAGATCTTTGAATATGAGATTGT 57.714 33.333 0.00 0.0 30.64 2.71
2017 2079 4.101448 ACATGAGCCAGCCGACCC 62.101 66.667 0.00 0.0 0.00 4.46
2753 2815 2.254546 ACTTGCAAGGTTGATGACGA 57.745 45.000 29.18 0.0 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.