Multiple sequence alignment - TraesCS2D01G574100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G574100 chr2D 100.000 2720 0 0 1 2720 638806162 638808881 0.000000e+00 5024.0
1 TraesCS2D01G574100 chr2D 96.820 2704 80 3 1 2700 638726017 638728718 0.000000e+00 4512.0
2 TraesCS2D01G574100 chr2D 79.797 688 98 21 1260 1931 638785419 638786081 1.910000e-126 462.0
3 TraesCS2D01G574100 chr2B 90.378 2775 165 29 1 2700 798130120 798132867 0.000000e+00 3552.0
4 TraesCS2D01G574100 chr2B 90.092 1201 102 7 1 1197 784190478 784191665 0.000000e+00 1543.0
5 TraesCS2D01G574100 chr2B 82.661 669 79 23 1194 1849 784191695 784192339 2.370000e-155 558.0
6 TraesCS2D01G574100 chr2A 93.200 1853 108 10 1 1850 764258034 764259871 0.000000e+00 2708.0
7 TraesCS2D01G574100 chr2A 91.282 1778 135 11 1 1771 764310842 764312606 0.000000e+00 2407.0
8 TraesCS2D01G574100 chr7D 82.266 1765 241 42 1 1727 460281577 460283307 0.000000e+00 1459.0
9 TraesCS2D01G574100 chr7D 80.420 1190 208 16 6 1191 459788361 459787193 0.000000e+00 883.0
10 TraesCS2D01G574100 chr7A 82.080 1769 243 47 1 1730 539324116 539322383 0.000000e+00 1443.0
11 TraesCS2D01G574100 chr7A 79.796 1762 277 49 6 1733 539447791 539446075 0.000000e+00 1208.0
12 TraesCS2D01G574100 chr7A 80.797 703 86 29 1044 1721 539403682 539403004 3.130000e-139 505.0
13 TraesCS2D01G574100 chr7B 84.622 1203 160 13 1 1199 482686223 482687404 0.000000e+00 1173.0
14 TraesCS2D01G574100 chr7B 79.133 1754 279 55 6 1721 482488338 482490042 0.000000e+00 1131.0
15 TraesCS2D01G574100 chr6B 97.059 34 1 0 2643 2676 207104477 207104444 1.050000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G574100 chr2D 638806162 638808881 2719 False 5024.0 5024 100.0000 1 2720 1 chr2D.!!$F3 2719
1 TraesCS2D01G574100 chr2D 638726017 638728718 2701 False 4512.0 4512 96.8200 1 2700 1 chr2D.!!$F1 2699
2 TraesCS2D01G574100 chr2D 638785419 638786081 662 False 462.0 462 79.7970 1260 1931 1 chr2D.!!$F2 671
3 TraesCS2D01G574100 chr2B 798130120 798132867 2747 False 3552.0 3552 90.3780 1 2700 1 chr2B.!!$F1 2699
4 TraesCS2D01G574100 chr2B 784190478 784192339 1861 False 1050.5 1543 86.3765 1 1849 2 chr2B.!!$F2 1848
5 TraesCS2D01G574100 chr2A 764258034 764259871 1837 False 2708.0 2708 93.2000 1 1850 1 chr2A.!!$F1 1849
6 TraesCS2D01G574100 chr2A 764310842 764312606 1764 False 2407.0 2407 91.2820 1 1771 1 chr2A.!!$F2 1770
7 TraesCS2D01G574100 chr7D 460281577 460283307 1730 False 1459.0 1459 82.2660 1 1727 1 chr7D.!!$F1 1726
8 TraesCS2D01G574100 chr7D 459787193 459788361 1168 True 883.0 883 80.4200 6 1191 1 chr7D.!!$R1 1185
9 TraesCS2D01G574100 chr7A 539322383 539324116 1733 True 1443.0 1443 82.0800 1 1730 1 chr7A.!!$R1 1729
10 TraesCS2D01G574100 chr7A 539446075 539447791 1716 True 1208.0 1208 79.7960 6 1733 1 chr7A.!!$R3 1727
11 TraesCS2D01G574100 chr7A 539403004 539403682 678 True 505.0 505 80.7970 1044 1721 1 chr7A.!!$R2 677
12 TraesCS2D01G574100 chr7B 482686223 482687404 1181 False 1173.0 1173 84.6220 1 1199 1 chr7B.!!$F2 1198
13 TraesCS2D01G574100 chr7B 482488338 482490042 1704 False 1131.0 1131 79.1330 6 1721 1 chr7B.!!$F1 1715

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
942 946 1.199097 GCCGTTGTGTATGGGTTCAAG 59.801 52.381 0.0 0.0 33.12 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2297 2397 0.109179 GCAATGAAGGCGCAATGTCA 60.109 50.0 10.83 6.89 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
338 339 5.009631 CACCAGGTGGAATGTTTCAGAATA 58.990 41.667 12.40 0.00 38.94 1.75
941 945 1.240256 GCCGTTGTGTATGGGTTCAA 58.760 50.000 0.00 0.00 33.12 2.69
942 946 1.199097 GCCGTTGTGTATGGGTTCAAG 59.801 52.381 0.00 0.00 33.12 3.02
1739 1795 4.978099 TGAGGAGAAGAAGCATTTCAACT 58.022 39.130 0.00 0.00 35.70 3.16
2225 2320 1.597854 CCTCGAACAGCCTGCACAA 60.598 57.895 0.00 0.00 0.00 3.33
2297 2397 1.831736 CCTACGAACAACCATCTCCCT 59.168 52.381 0.00 0.00 0.00 4.20
2632 2741 2.265739 CTAAGCAGCCGCACCAGA 59.734 61.111 0.00 0.00 42.27 3.86
2637 2746 4.383861 CAGCCGCACCAGAGCAGA 62.384 66.667 0.00 0.00 0.00 4.26
2697 2806 0.729140 GCAAGGCCAATTGTCGAACG 60.729 55.000 5.01 0.00 32.56 3.95
2699 2808 0.536460 AAGGCCAATTGTCGAACGGT 60.536 50.000 5.01 0.00 0.00 4.83
2700 2809 0.953960 AGGCCAATTGTCGAACGGTC 60.954 55.000 5.01 0.00 0.00 4.79
2701 2810 1.500396 GCCAATTGTCGAACGGTCC 59.500 57.895 4.43 0.00 0.00 4.46
2702 2811 1.918868 GCCAATTGTCGAACGGTCCC 61.919 60.000 4.43 0.00 0.00 4.46
2703 2812 0.321298 CCAATTGTCGAACGGTCCCT 60.321 55.000 4.43 0.00 0.00 4.20
2704 2813 0.796312 CAATTGTCGAACGGTCCCTG 59.204 55.000 0.00 0.00 0.00 4.45
2705 2814 0.321298 AATTGTCGAACGGTCCCTGG 60.321 55.000 0.00 0.00 0.00 4.45
2706 2815 2.180159 ATTGTCGAACGGTCCCTGGG 62.180 60.000 6.33 6.33 0.00 4.45
2707 2816 4.754667 GTCGAACGGTCCCTGGGC 62.755 72.222 8.22 2.97 0.00 5.36
2710 2819 4.011517 GAACGGTCCCTGGGCGAA 62.012 66.667 17.93 0.00 0.00 4.70
2711 2820 3.952628 GAACGGTCCCTGGGCGAAG 62.953 68.421 17.93 7.59 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
338 339 5.751586 TCCTTGTAAGAACACCTCACTTTT 58.248 37.500 0.00 0.00 34.61 2.27
941 945 3.323403 GTCCACTGCTATTGCTATCCTCT 59.677 47.826 0.00 0.00 40.48 3.69
942 946 3.070159 TGTCCACTGCTATTGCTATCCTC 59.930 47.826 0.00 0.00 40.48 3.71
2225 2320 4.954970 CGTGTGCTGCCCCTTGGT 62.955 66.667 0.00 0.00 0.00 3.67
2297 2397 0.109179 GCAATGAAGGCGCAATGTCA 60.109 50.000 10.83 6.89 0.00 3.58
2632 2741 3.726144 GGCCTTCCCAGCTCTGCT 61.726 66.667 0.00 0.00 40.77 4.24
2687 2796 1.295423 CCAGGGACCGTTCGACAAT 59.705 57.895 0.00 0.00 0.00 2.71
2688 2797 2.738480 CCAGGGACCGTTCGACAA 59.262 61.111 0.00 0.00 0.00 3.18
2697 2806 4.785453 CTGCTTCGCCCAGGGACC 62.785 72.222 10.89 0.00 0.00 4.46
2699 2808 3.393970 CTCTGCTTCGCCCAGGGA 61.394 66.667 10.89 0.00 32.44 4.20
2700 2809 4.479993 CCTCTGCTTCGCCCAGGG 62.480 72.222 0.00 0.00 0.00 4.45
2701 2810 3.393970 TCCTCTGCTTCGCCCAGG 61.394 66.667 0.00 0.00 0.00 4.45
2702 2811 2.125350 GTCCTCTGCTTCGCCCAG 60.125 66.667 0.00 0.00 0.00 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.