Multiple sequence alignment - TraesCS2D01G573100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G573100 chr2D 100.000 2213 0 0 1 2213 638424521 638426733 0.000000e+00 4087.0
1 TraesCS2D01G573100 chr2D 95.676 185 6 2 227 410 112181992 112182175 1.660000e-76 296.0
2 TraesCS2D01G573100 chr2D 100.000 28 0 0 149 176 383359889 383359916 4.000000e-03 52.8
3 TraesCS2D01G573100 chr5D 98.962 2216 20 3 1 2213 503291887 503294102 0.000000e+00 3962.0
4 TraesCS2D01G573100 chr5D 98.239 2215 20 5 1 2213 6176900 6174703 0.000000e+00 3856.0
5 TraesCS2D01G573100 chr5D 99.521 1878 7 2 1 1876 512417138 512419015 0.000000e+00 3417.0
6 TraesCS2D01G573100 chr5D 99.468 1879 7 3 1 1876 512410201 512412079 0.000000e+00 3411.0
7 TraesCS2D01G573100 chr1D 98.691 2216 23 6 1 2213 254435050 254437262 0.000000e+00 3927.0
8 TraesCS2D01G573100 chr1D 97.112 2216 51 8 1 2213 51871921 51869716 0.000000e+00 3725.0
9 TraesCS2D01G573100 chr4B 97.202 2216 56 6 3 2213 308679750 308677536 0.000000e+00 3744.0
10 TraesCS2D01G573100 chr4D 94.725 2218 100 13 1 2213 207068209 207066004 0.000000e+00 3432.0
11 TraesCS2D01G573100 chr1B 98.147 1889 30 5 328 2213 633708037 633709923 0.000000e+00 3290.0
12 TraesCS2D01G573100 chr2B 98.708 387 5 0 53 439 90714308 90713922 0.000000e+00 688.0
13 TraesCS2D01G573100 chr7B 96.379 359 12 1 1799 2156 590981172 590980814 6.810000e-165 590.0
14 TraesCS2D01G573100 chr3B 99.203 251 2 0 172 422 460131979 460132229 9.320000e-124 453.0
15 TraesCS2D01G573100 chr3A 97.872 141 3 0 1 141 418377297 418377157 6.100000e-61 244.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G573100 chr2D 638424521 638426733 2212 False 4087 4087 100.000 1 2213 1 chr2D.!!$F3 2212
1 TraesCS2D01G573100 chr5D 503291887 503294102 2215 False 3962 3962 98.962 1 2213 1 chr5D.!!$F1 2212
2 TraesCS2D01G573100 chr5D 6174703 6176900 2197 True 3856 3856 98.239 1 2213 1 chr5D.!!$R1 2212
3 TraesCS2D01G573100 chr5D 512417138 512419015 1877 False 3417 3417 99.521 1 1876 1 chr5D.!!$F3 1875
4 TraesCS2D01G573100 chr5D 512410201 512412079 1878 False 3411 3411 99.468 1 1876 1 chr5D.!!$F2 1875
5 TraesCS2D01G573100 chr1D 254435050 254437262 2212 False 3927 3927 98.691 1 2213 1 chr1D.!!$F1 2212
6 TraesCS2D01G573100 chr1D 51869716 51871921 2205 True 3725 3725 97.112 1 2213 1 chr1D.!!$R1 2212
7 TraesCS2D01G573100 chr4B 308677536 308679750 2214 True 3744 3744 97.202 3 2213 1 chr4B.!!$R1 2210
8 TraesCS2D01G573100 chr4D 207066004 207068209 2205 True 3432 3432 94.725 1 2213 1 chr4D.!!$R1 2212
9 TraesCS2D01G573100 chr1B 633708037 633709923 1886 False 3290 3290 98.147 328 2213 1 chr1B.!!$F1 1885

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
255 256 0.376502 GGTGACGTAGCTACCGAGAC 59.623 60.0 18.16 9.38 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2037 2055 2.100916 GCTCACGAGGCTCATAACCTTA 59.899 50.0 15.95 0.0 37.77 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
240 241 3.078837 GCTCTTTAAATTCCGTGGGTGA 58.921 45.455 0.00 0.00 0.00 4.02
255 256 0.376502 GGTGACGTAGCTACCGAGAC 59.623 60.000 18.16 9.38 0.00 3.36
2037 2055 0.036671 GGAATCGAACCCGTGACCTT 60.037 55.000 0.00 0.00 37.05 3.50
2081 2099 1.936547 CCAAACTGCTCTATTCCGCTC 59.063 52.381 0.00 0.00 0.00 5.03
2082 2100 2.419297 CCAAACTGCTCTATTCCGCTCT 60.419 50.000 0.00 0.00 0.00 4.09
2083 2101 3.181475 CCAAACTGCTCTATTCCGCTCTA 60.181 47.826 0.00 0.00 0.00 2.43
2084 2102 4.047822 CAAACTGCTCTATTCCGCTCTAG 58.952 47.826 0.00 0.00 0.00 2.43
2085 2103 3.216187 ACTGCTCTATTCCGCTCTAGA 57.784 47.619 0.00 0.00 0.00 2.43
2086 2104 3.146066 ACTGCTCTATTCCGCTCTAGAG 58.854 50.000 15.85 15.85 42.49 2.43
2087 2105 3.146066 CTGCTCTATTCCGCTCTAGAGT 58.854 50.000 20.75 3.40 41.91 3.24
2088 2106 4.202377 ACTGCTCTATTCCGCTCTAGAGTA 60.202 45.833 20.75 4.42 41.91 2.59
2089 2107 4.066490 TGCTCTATTCCGCTCTAGAGTAC 58.934 47.826 20.75 4.54 41.91 2.73
2090 2108 3.437741 GCTCTATTCCGCTCTAGAGTACC 59.562 52.174 20.75 3.82 41.91 3.34
2091 2109 4.643463 CTCTATTCCGCTCTAGAGTACCA 58.357 47.826 20.75 4.18 37.34 3.25
2092 2110 4.643463 TCTATTCCGCTCTAGAGTACCAG 58.357 47.826 20.75 10.71 0.00 4.00
2093 2111 3.579534 ATTCCGCTCTAGAGTACCAGA 57.420 47.619 20.75 8.14 0.00 3.86
2094 2112 3.361281 TTCCGCTCTAGAGTACCAGAA 57.639 47.619 20.75 12.99 0.00 3.02
2095 2113 3.361281 TCCGCTCTAGAGTACCAGAAA 57.639 47.619 20.75 0.00 0.00 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
240 241 1.404391 CATTGGTCTCGGTAGCTACGT 59.596 52.381 17.48 0.00 0.00 3.57
255 256 6.769822 AGGAGAGACATAATTAACTGCATTGG 59.230 38.462 0.00 0.00 0.00 3.16
907 914 5.603813 AGGGGTTTAATCATGAATCCATTGG 59.396 40.000 0.00 0.00 26.81 3.16
2037 2055 2.100916 GCTCACGAGGCTCATAACCTTA 59.899 50.000 15.95 0.00 37.77 2.69
2074 2092 3.361281 TTCTGGTACTCTAGAGCGGAA 57.639 47.619 19.97 15.97 37.35 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.