Multiple sequence alignment - TraesCS2D01G569300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G569300 chr2D 100.000 2843 0 0 1 2843 637321130 637318288 0.000000e+00 5251
1 TraesCS2D01G569300 chr2D 97.728 1981 42 3 1 1980 39496945 39498923 0.000000e+00 3406
2 TraesCS2D01G569300 chr6D 98.735 2845 31 5 1 2843 108464348 108467189 0.000000e+00 5049
3 TraesCS2D01G569300 chr6D 97.864 796 15 1 2050 2843 57919866 57920661 0.000000e+00 1375
4 TraesCS2D01G569300 chr7D 98.455 2847 25 5 1 2843 579026374 579029205 0.000000e+00 4996
5 TraesCS2D01G569300 chr7D 100.000 102 0 0 1967 2068 606866649 606866548 3.740000e-44 189
6 TraesCS2D01G569300 chr7D 100.000 74 0 0 1981 2054 606872725 606872652 1.370000e-28 137
7 TraesCS2D01G569300 chr5A 98.743 1909 23 1 1 1908 73031591 73033499 0.000000e+00 3391
8 TraesCS2D01G569300 chr3D 97.863 1965 36 5 1 1964 523759615 523761574 0.000000e+00 3391
9 TraesCS2D01G569300 chr3D 97.872 94 2 0 1904 1997 213401318 213401411 2.270000e-36 163
10 TraesCS2D01G569300 chr1B 98.533 1909 26 2 1 1908 638750010 638748103 0.000000e+00 3369
11 TraesCS2D01G569300 chr7A 98.428 1909 24 5 1 1908 60106997 60105094 0.000000e+00 3354
12 TraesCS2D01G569300 chr3B 97.905 1909 38 2 1 1908 575754724 575752817 0.000000e+00 3302
13 TraesCS2D01G569300 chr3B 97.862 795 14 3 2050 2843 39815071 39815863 0.000000e+00 1371
14 TraesCS2D01G569300 chr2B 97.905 1909 38 2 1 1908 500714118 500716025 0.000000e+00 3302
15 TraesCS2D01G569300 chr2B 97.733 794 17 1 2050 2843 357277252 357276460 0.000000e+00 1365
16 TraesCS2D01G569300 chr4D 98.741 794 9 1 2050 2843 123738965 123738173 0.000000e+00 1410
17 TraesCS2D01G569300 chr4D 98.615 794 11 0 2050 2843 123656168 123655375 0.000000e+00 1406
18 TraesCS2D01G569300 chr4D 98.365 795 12 1 2050 2843 123509470 123508676 0.000000e+00 1395
19 TraesCS2D01G569300 chr7B 98.111 794 15 0 2050 2843 139543497 139542704 0.000000e+00 1384
20 TraesCS2D01G569300 chr5D 97.810 137 3 0 1921 2057 469489542 469489678 1.320000e-58 237
21 TraesCS2D01G569300 chrUn 88.235 102 7 5 1959 2057 182412982 182412883 1.790000e-22 117
22 TraesCS2D01G569300 chrUn 88.235 102 7 5 1959 2057 371043417 371043318 1.790000e-22 117


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G569300 chr2D 637318288 637321130 2842 True 5251 5251 100.000 1 2843 1 chr2D.!!$R1 2842
1 TraesCS2D01G569300 chr2D 39496945 39498923 1978 False 3406 3406 97.728 1 1980 1 chr2D.!!$F1 1979
2 TraesCS2D01G569300 chr6D 108464348 108467189 2841 False 5049 5049 98.735 1 2843 1 chr6D.!!$F2 2842
3 TraesCS2D01G569300 chr6D 57919866 57920661 795 False 1375 1375 97.864 2050 2843 1 chr6D.!!$F1 793
4 TraesCS2D01G569300 chr7D 579026374 579029205 2831 False 4996 4996 98.455 1 2843 1 chr7D.!!$F1 2842
5 TraesCS2D01G569300 chr5A 73031591 73033499 1908 False 3391 3391 98.743 1 1908 1 chr5A.!!$F1 1907
6 TraesCS2D01G569300 chr3D 523759615 523761574 1959 False 3391 3391 97.863 1 1964 1 chr3D.!!$F2 1963
7 TraesCS2D01G569300 chr1B 638748103 638750010 1907 True 3369 3369 98.533 1 1908 1 chr1B.!!$R1 1907
8 TraesCS2D01G569300 chr7A 60105094 60106997 1903 True 3354 3354 98.428 1 1908 1 chr7A.!!$R1 1907
9 TraesCS2D01G569300 chr3B 575752817 575754724 1907 True 3302 3302 97.905 1 1908 1 chr3B.!!$R1 1907
10 TraesCS2D01G569300 chr3B 39815071 39815863 792 False 1371 1371 97.862 2050 2843 1 chr3B.!!$F1 793
11 TraesCS2D01G569300 chr2B 500714118 500716025 1907 False 3302 3302 97.905 1 1908 1 chr2B.!!$F1 1907
12 TraesCS2D01G569300 chr2B 357276460 357277252 792 True 1365 1365 97.733 2050 2843 1 chr2B.!!$R1 793
13 TraesCS2D01G569300 chr4D 123738173 123738965 792 True 1410 1410 98.741 2050 2843 1 chr4D.!!$R3 793
14 TraesCS2D01G569300 chr4D 123655375 123656168 793 True 1406 1406 98.615 2050 2843 1 chr4D.!!$R2 793
15 TraesCS2D01G569300 chr4D 123508676 123509470 794 True 1395 1395 98.365 2050 2843 1 chr4D.!!$R1 793
16 TraesCS2D01G569300 chr7B 139542704 139543497 793 True 1384 1384 98.111 2050 2843 1 chr7B.!!$R1 793

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
787 792 0.394565 AAGTCAGAGTCTGGGTGTGC 59.605 55.0 19.99 4.4 31.51 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2399 2421 8.206867 CCTCACTCCTCATCATAACTCAAATAA 58.793 37.037 0.0 0.0 0.0 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 233 2.558795 CCCGATCTTCCGTCTGATATGT 59.441 50.000 0.00 0.0 0.00 2.29
787 792 0.394565 AAGTCAGAGTCTGGGTGTGC 59.605 55.000 19.99 4.4 31.51 4.57
833 838 5.008712 GGTTCCGAATGATAAAGACCAATCC 59.991 44.000 0.00 0.0 0.00 3.01
864 869 2.037511 TCGTTTCGTTGGTAGAACCCAT 59.962 45.455 0.00 0.0 37.50 4.00
1109 1127 1.286553 TCCATGGCCTATTTCGGGTTT 59.713 47.619 6.96 0.0 0.00 3.27
1274 1292 4.046286 TGGAAGGGCATCATACAAAAGT 57.954 40.909 0.00 0.0 0.00 2.66
1367 1385 6.484364 TTTTTGGGCTTCTTCTCATTCTTT 57.516 33.333 0.00 0.0 0.00 2.52
2384 2406 8.902540 ATTGCTTACGTGAGGAAATATCAATA 57.097 30.769 17.73 0.0 30.22 1.90
2392 2414 7.993183 ACGTGAGGAAATATCAATATGGAACTT 59.007 33.333 0.00 0.0 0.00 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 233 5.998981 ACAACTTATAACGATGTTTGTCCCA 59.001 36.000 0.00 0.00 0.0 4.37
606 610 5.079643 TCCAAGAGTACTACCCTTTACGTT 58.920 41.667 0.00 0.00 0.0 3.99
787 792 7.110043 ACCCTCTCCGTATTAGTAAGAAAAG 57.890 40.000 0.00 0.00 0.0 2.27
833 838 4.408694 ACCAACGAAACGAAGAAGTTTTG 58.591 39.130 7.94 7.94 46.0 2.44
1109 1127 0.321298 GGTTGCCAAAGCTCCGAGTA 60.321 55.000 0.00 0.00 40.8 2.59
1274 1292 6.325545 ACCATATCGAGGTCCTAATTGTACAA 59.674 38.462 11.41 11.41 32.9 2.41
2399 2421 8.206867 CCTCACTCCTCATCATAACTCAAATAA 58.793 37.037 0.00 0.00 0.0 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.