Multiple sequence alignment - TraesCS2D01G569200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G569200 chr2D 100.000 2351 0 0 1 2351 637309597 637307247 0 4342
1 TraesCS2D01G569200 chr2D 98.130 2353 36 6 1 2351 306151995 306154341 0 4095
2 TraesCS2D01G569200 chrUn 98.980 2352 22 2 1 2351 257943220 257945570 0 4209
3 TraesCS2D01G569200 chrUn 98.724 2352 23 3 1 2351 233526160 233523815 0 4170
4 TraesCS2D01G569200 chr4D 98.597 2352 32 1 1 2351 123688069 123690420 0 4159
5 TraesCS2D01G569200 chr6D 97.833 2353 48 3 1 2351 283186520 283188871 0 4060
6 TraesCS2D01G569200 chr7D 97.704 2352 50 4 1 2351 307088605 307090953 0 4041
7 TraesCS2D01G569200 chr7A 98.383 2288 31 2 65 2351 60097027 60094745 0 4015
8 TraesCS2D01G569200 chr4B 97.449 2352 52 4 1 2351 495538666 495536322 0 4004
9 TraesCS2D01G569200 chr2A 97.025 2353 68 2 1 2351 444302026 444304378 0 3956


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G569200 chr2D 637307247 637309597 2350 True 4342 4342 100.000 1 2351 1 chr2D.!!$R1 2350
1 TraesCS2D01G569200 chr2D 306151995 306154341 2346 False 4095 4095 98.130 1 2351 1 chr2D.!!$F1 2350
2 TraesCS2D01G569200 chrUn 257943220 257945570 2350 False 4209 4209 98.980 1 2351 1 chrUn.!!$F1 2350
3 TraesCS2D01G569200 chrUn 233523815 233526160 2345 True 4170 4170 98.724 1 2351 1 chrUn.!!$R1 2350
4 TraesCS2D01G569200 chr4D 123688069 123690420 2351 False 4159 4159 98.597 1 2351 1 chr4D.!!$F1 2350
5 TraesCS2D01G569200 chr6D 283186520 283188871 2351 False 4060 4060 97.833 1 2351 1 chr6D.!!$F1 2350
6 TraesCS2D01G569200 chr7D 307088605 307090953 2348 False 4041 4041 97.704 1 2351 1 chr7D.!!$F1 2350
7 TraesCS2D01G569200 chr7A 60094745 60097027 2282 True 4015 4015 98.383 65 2351 1 chr7A.!!$R1 2286
8 TraesCS2D01G569200 chr4B 495536322 495538666 2344 True 4004 4004 97.449 1 2351 1 chr4B.!!$R1 2350
9 TraesCS2D01G569200 chr2A 444302026 444304378 2352 False 3956 3956 97.025 1 2351 1 chr2A.!!$F1 2350

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
344 346 1.002087 AGTTTTTCCCTCGCATCTCGT 59.998 47.619 0.0 0.0 39.67 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2219 2225 0.106708 CATCCTATGTCACCCCCACG 59.893 60.0 0.0 0.0 0.0 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 346 1.002087 AGTTTTTCCCTCGCATCTCGT 59.998 47.619 0.00 0.00 39.67 4.18
437 439 7.752686 GTCATTTTCTCATTACTTTGGCTCTTC 59.247 37.037 0.00 0.00 0.00 2.87
577 582 9.520515 TCCTTGAGCTAATCTCTTATTGTTTTT 57.479 29.630 0.00 0.00 42.38 1.94
837 842 9.246670 ACAAATCTCCATCAAAATGAGTCATTA 57.753 29.630 18.56 4.06 32.43 1.90
1569 1575 0.039074 CTTGGTCTCGCTCACTTCGT 60.039 55.000 0.00 0.00 0.00 3.85
1572 1578 1.579932 GTCTCGCTCACTTCGTCCA 59.420 57.895 0.00 0.00 0.00 4.02
1624 1630 0.175302 CGACAGCTTCTGCCTCTGAT 59.825 55.000 0.00 0.00 40.80 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 240 3.914426 ATAAGCTCGACCAAGGATTGT 57.086 42.857 0.00 0.00 46.99 2.71
344 346 9.771915 ACGAAATAACGAAAAAGTAAAAGTGAA 57.228 25.926 0.00 0.00 37.03 3.18
437 439 8.977505 CGTAATGCCTATAAAAATGGAAAATGG 58.022 33.333 0.00 0.00 0.00 3.16
577 582 5.424757 ACGTATTCCTAAGCTTAATGCACA 58.575 37.500 7.74 0.00 45.94 4.57
837 842 7.700656 CGGCTCCTCGTTTTTATTCAATTATTT 59.299 33.333 0.00 0.00 0.00 1.40
1299 1305 5.220662 CCTTGCATTAGTATGAGTTCGTTGG 60.221 44.000 0.00 0.00 33.37 3.77
1569 1575 1.531423 GAGCCGATACGATAGGTGGA 58.469 55.000 0.00 0.00 43.77 4.02
1572 1578 1.584380 GCCGAGCCGATACGATAGGT 61.584 60.000 0.00 0.00 43.77 3.08
1624 1630 1.756538 TCATGAGCGATAGTGAAGCCA 59.243 47.619 0.00 0.00 39.35 4.75
1866 1872 6.912082 ACACGATCATTCACATCAATTGAAA 58.088 32.000 13.09 2.26 36.57 2.69
2219 2225 0.106708 CATCCTATGTCACCCCCACG 59.893 60.000 0.00 0.00 0.00 4.94
2232 2238 1.402968 GAACCGTACGAGCACATCCTA 59.597 52.381 18.76 0.00 0.00 2.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.