Multiple sequence alignment - TraesCS2D01G566200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G566200 chr2D 100.000 3135 0 0 1 3135 635523576 635520442 0 5790
1 TraesCS2D01G566200 chr2D 99.043 3135 30 0 1 3135 635507645 635504511 0 5624
2 TraesCS2D01G566200 chr2D 98.852 3135 36 0 1 3135 635515595 635512461 0 5590
3 TraesCS2D01G566200 chr2D 98.629 3136 42 1 1 3135 635576945 635573810 0 5552
4 TraesCS2D01G566200 chr2D 98.565 3136 41 2 1 3135 635540218 635537086 0 5539
5 TraesCS2D01G566200 chr2D 98.438 3137 46 2 1 3135 635499669 635496534 0 5518
6 TraesCS2D01G566200 chr2D 98.278 3135 53 1 1 3135 635532244 635529111 0 5489
7 TraesCS2D01G566200 chrUn 98.501 3135 46 1 1 3134 31833996 31837130 0 5528
8 TraesCS2D01G566200 chrUn 98.501 3135 46 1 1 3134 31848530 31851664 0 5528
9 TraesCS2D01G566200 chrUn 98.423 2536 39 1 1 2535 31842678 31845213 0 4460


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G566200 chr2D 635520442 635523576 3134 True 5790 5790 100.000 1 3135 1 chr2D.!!$R4 3134
1 TraesCS2D01G566200 chr2D 635504511 635507645 3134 True 5624 5624 99.043 1 3135 1 chr2D.!!$R2 3134
2 TraesCS2D01G566200 chr2D 635512461 635515595 3134 True 5590 5590 98.852 1 3135 1 chr2D.!!$R3 3134
3 TraesCS2D01G566200 chr2D 635573810 635576945 3135 True 5552 5552 98.629 1 3135 1 chr2D.!!$R7 3134
4 TraesCS2D01G566200 chr2D 635537086 635540218 3132 True 5539 5539 98.565 1 3135 1 chr2D.!!$R6 3134
5 TraesCS2D01G566200 chr2D 635496534 635499669 3135 True 5518 5518 98.438 1 3135 1 chr2D.!!$R1 3134
6 TraesCS2D01G566200 chr2D 635529111 635532244 3133 True 5489 5489 98.278 1 3135 1 chr2D.!!$R5 3134
7 TraesCS2D01G566200 chrUn 31833996 31837130 3134 False 5528 5528 98.501 1 3134 1 chrUn.!!$F1 3133
8 TraesCS2D01G566200 chrUn 31842678 31851664 8986 False 4994 5528 98.462 1 3134 2 chrUn.!!$F2 3133

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
852 6708 2.963599 TACCCTTTTCACCCCTCAAC 57.036 50.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2791 8647 6.76077 TGGTAGGTTCAAGCAAAATGAAAAAG 59.239 34.615 0.0 0.0 38.44 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 5900 5.355910 GTCAGTTTGGAACCAGACAAGTTTA 59.644 40.000 15.12 0.0 37.09 2.01
48 5901 5.588648 TCAGTTTGGAACCAGACAAGTTTAG 59.411 40.000 15.12 0.0 34.04 1.85
178 6033 9.502091 TGTAGAGTTAAAATACAATGAGTGCTT 57.498 29.630 0.00 0.0 0.00 3.91
254 6109 4.377431 CCTCACATTAAACGAGTGTTCAGC 60.377 45.833 0.00 0.0 37.31 4.26
263 6118 3.990092 ACGAGTGTTCAGCATAGAAACA 58.010 40.909 0.00 0.0 0.00 2.83
852 6708 2.963599 TACCCTTTTCACCCCTCAAC 57.036 50.000 0.00 0.0 0.00 3.18
1226 7082 4.883585 AGATGCACCAACATACATACCAAG 59.116 41.667 0.00 0.0 0.00 3.61
1293 7149 6.998074 TCAACATTCAACCAAAGTATCTCACT 59.002 34.615 0.00 0.0 40.05 3.41
1383 7239 0.663153 GCACCACAGTCAAGTTCACC 59.337 55.000 0.00 0.0 0.00 4.02
2241 8097 6.759497 AGATCAAGGGCAACATAGTTAAAC 57.241 37.500 0.00 0.0 39.74 2.01
2355 8211 6.020360 GCTTGTGTTTGAAAATGTCTGAGTTC 60.020 38.462 0.00 0.0 0.00 3.01
2791 8647 6.668541 TTGTAATCTTATTGTGCAGAGAGC 57.331 37.500 0.00 0.0 45.96 4.09
2823 8680 2.092646 TGCTTGAACCTACCACTGTGTT 60.093 45.455 7.08 0.0 0.00 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 5900 0.673644 CTGTCCCGATGCGGTTTTCT 60.674 55.000 5.06 0.00 46.80 2.52
48 5901 1.644786 CCTGTCCCGATGCGGTTTTC 61.645 60.000 5.06 0.00 46.80 2.29
178 6033 4.453136 GTCCTACGCCTGAACAACAAATTA 59.547 41.667 0.00 0.00 0.00 1.40
633 6489 1.798223 CTTTCCTTTCGCATCGTCACA 59.202 47.619 0.00 0.00 0.00 3.58
1226 7082 5.355910 TCCAAGTACTTCACAAACAAGGTTC 59.644 40.000 4.77 0.00 0.00 3.62
1383 7239 5.925969 ACTTTCCACAACAAGAAACTTTGTG 59.074 36.000 6.69 6.69 46.39 3.33
1403 7259 4.284490 TCTCTGCACTATTCTCACCACTTT 59.716 41.667 0.00 0.00 0.00 2.66
2241 8097 9.635520 AAATGAGATTCTTTTACTGCATTGAAG 57.364 29.630 0.00 0.00 0.00 3.02
2791 8647 6.760770 TGGTAGGTTCAAGCAAAATGAAAAAG 59.239 34.615 0.00 0.00 38.44 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.